Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2719
Contig Information
Length 809 bp
Tissue Shoot grown under continuous light
Clones 34 Clones [Download: CSV  ,  FASTA ]
whkp12g16    whkp12h03    whkp6d13    whkp7l07    whkp8b12    whkp8m10    whkp8m21    whkp13j01    whkp15f16    whkp15n19    whkp16k23    whkp18f20    whkp18p18    whkp19e04    whkp19g04    whkp20l15    rwhkp12b21    rwhkp12g16    rwhkp12h03    rwhkp6d13    rwhkp7l07    rwhkp8b12    rwhkp8k02    rwhkp8m10    rwhkp8m21    rwhkp13j01    rwhkp15f16    rwhkp15n19    rwhkp16k23    rwhkp18f20    rwhkp18p18    rwhkp19e04    rwhkp19g04    rwhkp20l15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum]
Score 917
Evalue 4.68868e-97
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2719
TTTTTTTTTTAAAGAAACTTTTCCTGAATTAATAACAGCAAGACAATGGTCCGCGTGTTTGTATATAATAAATATCACACAGGTTTTGTATATGTGTAGC
CGGTTCTAGAATTTACATATGCATGCTCGAGAACCTATGTTCGTACATACACACACAGACCATATAGAATGAAAAATATGCTCTGGTCGTCCAGCAGAGT
GGTGGACAAAAGTTAAGTTCACAAAAGACCTTCATACATAGGCCATTGTTTCAACTCGTAGTTTAGGCCTTGCCAGACTCCTCGCAACCCGGTGGCCTGA
AGGCGATGAAGCTGACGCACTGCACCTGGCGCAGGTTGTCGAAGCCGATGACGCGGACATAGGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTT
GAGCACCTGTGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTATCGACCATCGTAGTACCCGGGGGAGCTGTTGTGCTCACGGAAA
ACGAAGCCAACCTTGCTGAACTCGAGGCAGGGCACCCACTTGGAGCGGATCAAGTAGTCGACCTGCTTCAGGAGGGCCTCCGTGGAGAGGGGTGGCAAGT
AAGACAGGGTCTCGAACTTCTTGATGCCCTCAATCGGCCACACCTGCATGCACCTGATCCTTCCGCCGTTGCTGACGCTGCCGAGGCCGGCGCTGCTGGA
GCGGCGGCTGACGGGCAGGCCCGCGGTGGACTTGAGACCCTGGAAGGGTGCGACGGAGGTGGCCGAGGAAGCCATCACAGTGGGGGCCATGGTGTTGGAG
GAGGGAAGG
page-top