Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2712
Contig Information
Length 2022 bp
Tissue Shoot grown under continuous light
Clones 24 Clones [Download: CSV  ,  FASTA ]
whkp10e06    whkp2o23    whkp3a03    whkp4d06    whkp5m11    whkp15f14    whkp15o02    whkp15o13    whkp17g04    rwhkp1o19    rwhkp2d19    rwhkp2o23    rwhkp3a03    rwhkp3i11    rwhkp4d06    rwhkp5d23    rwhkp5m11    rwhkp14e19    rwhkp15f14    rwhkp15o02    rwhkp15o13    rwhkp17g04    rwhkp20p20    rwhkp20p21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase precursor [Triticum aestivum]
Score 2003
Evalue 0
Total Hit Count 362
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2712
CGACATGGTTCCAGCCGATTGTTGGACGATACTGCAATTCAGGCCATCGATACCTAGTACTAGGTGCAACACAGCCACTAGATTAAGAATCGTGCTTGAA
TCGTCCAACAGCTATCGGCTGGTGAAGTAGTTTCGATTACAGAACATGAATATGATAACAAAGTGACACTCGTCTTAGAAAAAAAATGCTTATTTATCAG
TTTGAGACAACTTCTCCCCAGAAGTACGCTCATTGTGGCAGACGCAGCAAACCACCTAGAGCTAATAGTTTATTCGGAGTAGCAATAGCCTGGCCAGCTG
CTTCACAGTAACCAAACGACAAACTTAGTCAGAACAAAGTCCACAGACGGAACAGCGACAGCCAATCACTCGCACAGCACCGCGCCCTCCTCCAGGGAAT
CCTCCTCCGCCCGCCATGCGAGGAGGTTGGCGAGCTTGCCTTCCTTGACCAGAGGGTGGCTCTGCACACTCTCGGCCTCGAAGCAGTGGAAGACGGACCT
GGGCGACCCGGCAGAGACAGCAACCTCTTCGTTCGCGGCAAAGCTCTGGTAGATGAGGACGCCCCCGCAGGGGAGCTCCTGCTCCACAACGTTGTTGCAG
TCGTATGCCTCAGCTTCGAGCTTCTTGCCCCAGGTGGCGGCGTGGCCACGGCCACCGAAGATGGTGACCGCCACAGAGAACTCTGAAGGGCCAAAGCACC
GGAGGACCCTCTTGACGATGTCGCCGTAGGCCAGGGCGGAGGCGTCCATGCCCATGACCTCGTAGCTCGCGTAGCTGAAGCCGTCCTCGGGGGTCACATG
GATGGTGGAGACGGCAGATCCGTTGATGGCGTTCATGGAGTAGCCGCAGGGCTCGAAGTCGAAGTCACAGACCTCCATCTCAGGGATAATGTCAGAGATT
CCAGAGAGCTTGGTCATCTCCTTGGCACAGGAAACGTGGCCATCAGCTTGAGTCTTGAAGAAGACAGAGGCCTTCTTCTTGTCCAGCCCAGTCATGCACA
TCTCCAGGGTGACCATGGGCTGCTCAGGTTGCTCGGTGGCATAGTAGATGTGCCACTTCTGGCCAGGCTTCGCTGGGTCTCCGATCACATAAGCATTGCC
ACCAGACTTCAGGTGGCCGAAGTAGCGGTTCAGGACATCAACCTCCTCAGAGAAGCTCCTGTGGGGAGCAGGCTGTGCGCCGGGGAAGATGAACATCCCA
CGAGAGTACTTGACGGCAGCAAGCGGCATGCACAGCTCTTCAGCAAGCTCAAGAATCCTAGGAATGGTGAGCAGGAGCATGGTAGTCCCACAGGTCTTGA
TCACAATCTTCTGAGAATAGATGAACAGGCTGGACTCAGATAGCACATACGAGTCGAAGTCCTTGTTGGAGAGCTCGGACACAATGGTGCACCGTGCAAG
ATCAAGAACAGAGTCAATCTGGGCCCTAGAGAGGGCGCGCAGGCCACGACCATGAGGGTCGGCAAAGATCGATGCCTCGGAGAAGGTGATCTCGAGGCGC
TTCTCGTAGCCCTCGAACCCGATTGCAGAGGTCGGGGCAGCCATTGTTGCAGTTTGAGTCAGAAAGCAGAGCAGAGAGGAACAGAGGGAGTAAGACTAGA
GAACTGGTCGATTATCGTGAAGCAGGCCAGAGAGATTGGTGGGAGAAAAGAGTCAGAATAAAATTGCATAAAAATCCTAAACTACGGGAAGGGGATGCCA
AAAACGATATCAGGATGGCTTCTTCGCGCAGTTCGAGTATGCAGCAGAGAACTTCTTGGCGCCTCCAGCAGGTCGAACGTCTTCAATGCTGTAGCCGAGG
GGAGCTTCGTACATCAGGGAACTACTACTGCTAGACTTTTTGCCACCCTTTGACTCCATTAGCACATTCACTAAAGGTTCCTGGGAAAAATTGTATGGTA
ACCCCGATCCCGAGCGCGCCCGCTTGTTCCGATTCCGATCTCAAGAATTCCCCCTCTCCCGACACAGATCTCGAGCACTCCCAACGAGTTCTGCTCTCTC
TTTTTTTCTTATCTAGCTGTGG
page-top