Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2711
Contig Information
Length 1355 bp
Tissue Shoot grown under continuous light
Clones 24 Clones [Download: CSV  ,  FASTA ]
whkp10b02    whkp10g22    whkp2e14    whkp4i11    whkp7j15    whkp9p11    whkp15g21    whkp17j24    whkp19b21    whkp19e10    whkp20c12    whkp20m19    rwhkp10b02    rwhkp10g22    rwhkp2e14    rwhkp4i11    rwhkp7j15    rwhkp9p11    rwhkp15g21    rwhkp17j24    rwhkp19b21    rwhkp19e10    rwhkp20c12    rwhkp20m19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0124900 [Oryza sativa (japonica cultivar-group)] >gi|113594686|dbj|BAF18560.1| Os06g0124900 [Oryza sativa (japonica cultivar-group)]
Score 204
Evalue 5.00873e-14
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2711
CGATCTCCCCCGAATCCAAATCCAAATCCAATCCGCCGCGGAAGAAGCGAGGATGATCTACCGCAACTGGTCCCTGCTCTCCTCCACGGTCGTCATCTGG
GGCAGCGTCGGCGCCGCCGGCCTCGCCGGGATCTTCCTCTTCGGCGGCAAGGAGAAATTCCAGGGCTATCTTTCTCGCGAAGGCGAGAGGCTGAGGCAGC
AGGACAGAGCCATGATGGGCAAGAACTAGTGCAGACCACGGCTCACTTTCGACGTGTCAACATGTGAACTAGACATGGAACGAAGTATCTCTATGATATA
GAACATACAAATTATCTCTGCCTTCCAATGCCACCTTTTGCTTCTGCCCCCCATGAATAATACTGACGCGGATGTTCATTCTGTTCCCCCATGAATGTTC
TCGACGCCATGTTTGCTCTGTTCCCTTTGGTAGCCTGCTGTTTGTCGACTTTGTTCTGGCGCTCTGAATAAGTTTTGGCAGGGCACGCTCCGTTATCCAA
TCCGGCGTCCTGCACGCACACCATGTAGGCCACAAGATCTCAGATAGCTTATGTCATTGGTGGTGGCATAAGCTACCAGTACCAGCTGCATGCCTGTGCT
CTTCTTCGCTTGGAGTGTGCCCTCGGCCATGGCCCGTGGGCGCGTACGCAGCAACCCAGGGCATGGATCCGGCGTTGGCTAGCTACCTCTGGCCTGCATC
AAGCTGCAGCTGGCTAGGCTGCTTGGTTTCTTGAGGAAGCTCGGGGTGAAACTGCCATGGCTGGCCGGCAGGGGCGGCCTCGTCCACGGCGGCGGCGGCG
ACTTCTCACCTCTACTAAGGTAGGGCAACTTCTATCCTTTGGCAATTGTGACTTCTCGATCGGTAGTTGGGCGTGATGATCTCTCTCCTCCGAGTAGAGC
ACCGGTGGAGATCATAGCACGGTGCACGTGTGTGCGTATCCTCTGTATCGTCGTGTAACTACTAGCTAGCTATACCAAGTTGATATGAAGCTAGTGTGGT
TGTATGTGTGATCCTGCTTGAGTCTTTTGGTTCTGTGATCTGTGGGCAGTATATGTGTTGAGTTTTGTACGTATCTGGTAAGACTAGTGCCATCAGTCGA
TAAATATAAATTTGACGTTTGCACACAGATTGTGCTTGTAAGATACTGATACTCCTCCGTTGATGTACAACGGTCGGTCGCTGCATGTTCTATTCTTCGG
TTGATTTCGGAATCATACCAATATTGTTCTGATATACTCGATCATCAGGCATCAGCACAGCACTCTCCCGGCCTTTGTTCACTTATCAATTTGTCAGGCT
TAGAAACTAGTAGTAGTACTGGCCTTCAGAAATTGTAAGGAAAAGGGGCCGCTTC
page-top