Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2704
Contig Information
Length 1040 bp
Tissue Shoot grown under continuous light
Clones 21 Clones [Download: CSV  ,  FASTA ]
whkp10f12    whkp12l11    whkp12l12    whkp12o20    whkp7k03    whkp8c23    whkp14n02    whkp20i17    whkp20i23    whkp20m11    rwhkp10f12    rwhkp12l11    rwhkp12l12    rwhkp12o20    rwhkp7k03    rwhkp8c23    rwhkp14n02    rwhkp20i17    rwhkp20i18    rwhkp20i23    rwhkp20m11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 1404
Evalue 2.41347e-153
Total Hit Count 183
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2704
TTTTTTTTTTGTGAACATTCATGGGGGATCAATATCATGAGTTGGCGAGGAAGAAACAATAACAGAAGCTAAAATATAAACCGACACCCTGGGGTTTAGA
TTACTAGATACACACACAAACACACATTGTTGCCTCGATTGTTTCCTCTCCAACGATCAACCCACGTACGCATGCACACAAGATGAGCATCTTCACTTCT
GCTCTGCTCTAGTTAGACTCGAGCTGCGCGTACCACACACCCTGGATCTTGACATCCTTGGGCGCCTTGGCGCCGAGGTCGGTGTCTGACGGCTGCACGC
TCTCGAAGACGCCGATCACCTCGCCGGTCTCCGGCTTGCTCTTGGTCACGCTGAGCGTGATGTTGCCTGTGGAGGAGGACGCGTTCTTCACGTTCTCCTT
GGCCAACTCCTCCTCGTCTCCTCTGCCTCCGGCGGGTAGCGCCACGGCGTTGTCGTAGCCAGTAGAGCCACCACGGCCCTTTGGGTCGAGGAAAGACGAA
CCCCTGTAGCTGGGCACAAGGAAGGGCCCGCTGAAGCTCTCGGGCTTGCCGGTGGCGACGAGCTGCTTGACGGTGAAGAGGAAGGGCACGCGCTCGCCTC
CGGGGAGCTGCACGGTGACGGCCGCATAGTCGATGCCGTCCTTCTCCTCGAACTTGAGGGTGCCGTCGGCGCCGACCTCGAGCGGGCCTTCCATCTCGTC
AAGGGTGTAGGTGAGACGGGTCATGAGCTTGGTCTTCTGGAAGGCCGGCGGCTCGTTCTTCTGGATGCCCTCGGCCTTGACGGTGAAGGAGGTGGGCTCC
AGGCAGAACTTCTTCATCTCGTACTTGCCGGCCTTGAAGGGGAAGGAGTCGACGCCGCCGTCGATGGTCGGGCACTGGTTCGCGGTGCCGGTACCCTTCA
CCTCCATGTAGGTCTTGCTCTGGATCTCGTCGAAGGTCAGCCTCTTGGGCGCCCCCTCCGCGCTCGCGCCGGAGACGAGGAGGGCAGAGGTGGCGAGGGC
GAAGCCGGCCATCTTGGCGGCGTCGGCGCACTTGCTGCGC
page-top