Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2703
Contig Information
Length 2183 bp
Tissue Shoot grown under continuous light
Clones 20 Clones [Download: CSV  ,  FASTA ]
whkp2h04    whkp2p06    whkp3j06    whkp3j17    whkp4n10    whkp5o18    whkp6e14    whkp6f01    whkp9e16    whkp14f23    whkp18e21    rwhkp2h04    rwhkp2p06    rwhkp3j06    rwhkp3j17    rwhkp4n10    rwhkp5o18    rwhkp6e14    rwhkp6f01    rwhkp18e21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0564100 [Oryza sativa (japonica cultivar-group)] >gi|28071305|dbj|BAC55994.1| putative iron inhibited ABC transporter 2 [Oryza sativa Japonica Group] >gi|42408451|dbj|BAD09633.1| putative iron inhibited ABC transporter 2 [Oryza sativa Japonica Group] >gi|113624497|dbj|BAF24442.1| Os08g0564100 [Oryza sativa (japonica cultivar-group)] >gi|125604356|gb|EAZ43681.1| hypothetical protein OsJ_027164 [Oryza sativa (japonica cultivar-group)] >gi|215693235|dbj|BAG88617.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201615|gb|EEC84042.1| hypothetical protein OsI_30302 [Oryza sativa Indica Group]
Score 2600
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2703
ACAGCCGCCGCCACCGCCCGCTGGGAGGGGAATAGAAATCGTGTGTATCGTAGGGTTGCGCGAATCGCCGTCTCCAGCAACCAATCCCCAACCCTCGAGC
TATCTAACTATCCCGATCCCGATCTCCTACCATGGTGTCCGATGCCAGCAAGAAGAAAGCCGCGCAGAAGAAGGCCGCCGCCGCCGCAAAGAGGGGAGCC
AAGTCCAGCGCCGCTGCCTCGTCCTCGTCGGCGTCGTCAGCGGCCGATAAGGCCGCCAATGGCATAGCGGCCCTTAACTTATCCGATCGGACATGTACCG
GGGTCCTGGCTTCGCATCCGCTCTCCCGTGATATCCACATTGAGTCCCTTTCATTAACATTTCATGGACATGACCTTATTGTGGATTCAGAATTGGAGCT
TAACTACGGGAGGCGGTATGGTTTGCTCGGCTTAAATGGTTGTGGGAAATCTACCCTTCTCACCGCAATAGGCTGCAGGGAACTCCCCATTCCTGAACAC
ATGGACATACATCATCTTACTCGTGAGATTGAGGCTTCTGACATGTCTGCGCTGCAAGCTGTTATCTGTTGTGATGAAGAAAGAGTGAAGTTGGAAAAGG
AAGCTGAAATTTTGGCTGCACAGGATGATGGTGGCGGTGAAGCTTTGGATCTTGTATATGAGCGGTTAGAAGCAATGGATGCATCAACTGCTGAAAAGCG
TGCTGCTGAGATATTGTTTGGTCTAGGTTTTGACAAGCAAATGCAAGCAAAGCCAACACGAGATTTTTCTGGGGGTTGGCGTATGAGGATTGCATTGGCA
AGGGCGCTGTTCATGAACCCGACCATCCTTTTGCTTGATGAGCCAACCAACCATCTTGATCTCGAGGCTTGTGTCTGGCTGGAAGAGAAATTAAAGAATT
TTGAGCGTATACTTGTTGTTATCTCGCATTCCCAAGATTTTCTAAATGGAGTGTGCACTAACATCATCCACATGCAGAACAAGACCCTCAAGTTATATAC
TGGAAATTATGACCAGTATGTTCAAACTCGCTCTGAGCTTGAAGAGAATCAAATGAAGCAGTACAAATGGGAACAGGAACAGATAGCTAATATGAAGGAG
TACATTGCACGATTTGGTCATGGATCTGCGAAGCTTGCTCGTCAGGCTCAGAGCAAAGAGAAGACTCTTGCAAAGATGGAGCGTGGTGGTCTTGCTGAGA
AGGTTGTCAATGACAGGATTCTTGTATTCCGCTTTACAGATGTTGGCAAACTCCCACCACCAGTGCTGCAGTTTGCTGATGTCACATTTGGTTACACTCC
GGATAATCTCATCTACAAGAACCTTGACTTCGGTGTTGACCTTGACTCGAGAGTTGCACTGGTCGGTCCCAATGGGGCTGGTAAGAGCACACTTCTGAAG
CTCATGACAGGTGACCTATCTCCGTTGGATGGCATGGTCAGACGCCACAACCACCTACGCATTGCACAATTCCATCAACATCTCACTGAGAAGCTGGACC
TGGACATGCCGGCCCTGCAGTACATGATGAGGGAGTACCCTGGGAATGAAGAGGAGAAGATGAGAGCTGCAATTGGCAAGTTTGGCCTGTCAGGAAAGGC
ACAGGTGATGCCAATGAAAAACCTGTCTGATGGGCAGAAGGCCCGTGTCATTTTTGCTTGGCTAGCATTTAGGCAGCCACAGATGCTGTTGCTTGATGAG
CCGACAAATCATCTTGACATTGAGACCATTGACTCACTTGCTGAGGCATTGAAGGAATGGGACGGGGGGTTGGTCCTGGTGAGCCATGACTTCAGGCTGA
TCAATCAGGTTGCTCAAGAGATCTGGGTCTGTGAGAACCAGGCGGTGACTAGGTGGGAAGGCGATATCATGGATTTCAAGCAACACTTGAAGAAAAGGGC
TGGTCTCTAGATTTCCTGTCTTTTCCTTCTCTCGGCTCTTTGGAGATCTAGACAACCCCAAAGTTTTGCCTCTGTATCAGAAAAGCTTCCATCATTTAGC
GTGACAAGTATGAGTACTATTGTATCGCTTAAAACATATCTTCTCTACGCTATTTTATAACCAGACGATCCGTATTTAATTTCATATCTTTAACATTGTT
GATCCATGATGGTTTGTTTTGCTCTGTGGTTCTAGATTTGAAGATTATCATTTTATAAGGTGATGAGATGTAGACATATTCAT
page-top