Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2697
Contig Information
Length 1040 bp
Tissue Shoot grown under continuous light
Clones 18 Clones [Download: CSV  ,  FASTA ]
whkp10e08    whkp10j02    whkp12h24    whkp3c04    whkp5b20    whkp5k04    whkp14g02    whkp19n15    rwhkp10j02    rwhkp12h24    rwhkp3c04    rwhkp5b20    rwhkp5k04    rwhkp13c09    rwhkp13g11    rwhkp13k17    rwhkp14g02    rwhkp19n15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|122246902|sp|Q10HD0|CB23_ORYSJ RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|152013384|sp|A2XJ35|CB23_ORYSI RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|50839002|gb|AAT81763.1| chlorophyll a/b binding protein [Oryza sativa (japonica cultivar-group)] >gi|108709618|gb|ABF97413.1| Chlorophyll a-b binding protein, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549057|dbj|BAF12500.1| Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|125544706|gb|EAY90845.1| hypothetical protein OsI_12453 [Oryza sativa Indica Group] >gi|125586998|gb|EAZ27662.1| hypothetical protein OsJ_011145 [Oryza sativa (japonica cultivar-group)]
Score 1256
Evalue 3.50124e-136
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2697
ATGTACTAATGATACACGATTCTTCCATCCATTTGCTCGTGCATCTCGTGCTTAATTAATTTACATTGGCGCGCAGCCAGCGAGAGGTCATCTCGCTCGC
TCGATCATGGTACAAATAAACACACAAAGTACGTGCAGCTACACGTTGATCCACGACGTACAAGTACACATGCATATCTCGTCCGATGGACGGACAGATG
GCTTAACACATTTAGCTTCCGGGGGCGAAGTTGGTGGCGAAGGCCCACGCGTTGTTGTTGACCGGGTCGGCGACGTGGTCGAAGAGGTTCTCTACGGGCC
CCTTTCCGGTGACGATGGCCTGCACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGAGCTCCTTGACCTTGAGCTCAGCTGCGGTGTC
GGGGTCGTCGGCGAGGCCAAGTGGGTCGAAGGCGCCGCCTGGGTAGATGATGTCGAGGCCCTCGCCGAGGGGGCCGCCACCAACGCGGTAACCCTCGATG
AAGCCCATGAGCACCACCTGAACCGCCCAGATGGCGAGGATGCTCTGCGCGTGCACCAGGTTGGGGTTGCCCAGGTAGTCGAGGCCGCCCTCGGAGAAGA
TCTGGGCACCGGCCTTGAACCACACGGCCTCGCCGAACTTGATGCCGTTCTTGGACAGGATCTCCGGGAACACGCACCCCAGGGCGCCGAGCATCGCCCA
CCGTGAGTGGATCACCTCCAGCTCCCGGTTCTTGGCGAAGGTCTCTGGGTCAGCCGACAATCCGGCGGTGTCCCACCCGTAGTCGCCGGGGAACTCGCCG
GTCAGGTACGACGGGGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCAGGGCCGTACCAGATGCTCTGGGGCGCGCTCTTGACGGTCCGGCGCA
TGGTGATGCGGCCGCCGAAGTCGCCGACGCTGCGGACGAGGTCATCACGCCGCGGGGCGGTGCCGAGGAAGCTGGTCGTCTGGTGCAGCGCCGACGCGGC
CATTTCGCTGGTGGCTGGGGCTGCCTGCGAGCTCAGTGAG
page-top