Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2696
Contig Information
Length 1199 bp
Tissue Shoot grown under continuous light
Clones 18 Clones [Download: CSV  ,  FASTA ]
whkp10n14    whkp11m01    whkp12d11    whkp3n08    whkp14m18    whkp15h03    whkp17c13    whkp17g08    whkp17g20    whkp20d04    rwhkp10n14    rwhkp12d11    rwhkp14m18    rwhkp15h03    rwhkp17c13    rwhkp17g08    rwhkp17g20    rwhkp20d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Precursor of CP29, core chlorophyll a/b binding (CAB) protein of photosystem II (PSII) [Hordeum vulgare subsp. vulgare] >gi|445122|prf||1908428A chlorophyll a/b-binding protein
Score 1338
Evalue 1.34825e-145
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2696
CTCCTTCTTGCTGAGCTGAGCACGCCCCTTCTCTCTCAACTTTGGGCTCGAGGCAATGGCGGCGCTCGCTCCGACGAAGATGCTCGGCACCCGGCTCAAC
TTCGCCGGCTCCTCCAGGTACGCCACAGCGGCACCAACTGCTGGCGCACAGAAGATCGTCTCCCTCTTTGATCGCTTCAAGAAGAAGCCTGCCCCGAAGC
CGAAGCCCGCCCCCGTGGCCACCTCGAGCGTAGGCATCGACGACGAGCTCGCCAAGTGGTACGGCCCTGACAGGAGGATCTACTTGCCCAACGGACTCCT
TGACCGGTCGGAGGTGCCGGAGTACCTCAACGGAGAGGTTCCCGGAGACTACGGCTATGATCCTTTTGGTCTGGGCAAGAAGCCAGAGGACTTCGCCAAG
TACCAGGCCTTTGAGCTCATCCATGCCAGGTGGGCCATGCTCGGCGCCGCCGGATTCATCATCCCCGAGGCGCTCAACAAGTTCGGCGCAAACTGCGGTC
CCGAGGCCGTTTGGTTCAAGACTGGCGCCCTTCTCCTTGACGGCAACACCCTCAACTACTTCGGCAACAGCATCCCCATCAACCTGATCCTCGCCGTCGT
CGCCGAGGTCGTCCTCGTCGGAGGCGCCGAGTACTACAGGATCACCAACGGACTGGAATTTGATGACAAGCTCCACCCCGGTGGCCCATTCGACCCGCTC
GGCCTCGCCACCGACCCCGACCAGGCGGCGCTGCTCAAGGTGAAGGAGATCAAGAACGGACGGCTGGCCATGTTCTCCATGCTGGGCTTCTTCATCCAGG
CCTACGTCACCGGCGAGGGCCCCTTTGAGAACCTGTGCGCGCACCTCAGCGACCCCTTCGGCAACAACCTGCTCACCGTCATCTCCGGCGCCGCCGAGAG
GGTGCCCAGCCTGTGAGCTGGCCGTTGATTGCCCGTCCGCCGCCGTCGGCTGTTGATGGATCAGCTGCGTGCGATGCGCGCGATGCAGCATCATGTGCTG
TGTGAATTTTACCGGGGAAAAGTATGAGAGTACGAATGTGCCGTACGTGTAAATTATCAAGGGCAGAAGAAACATGATCGTTCTGATTTCTGATGGGAGT
ATCGGACCACTGCTTCAGCTTGTGCTTGATTTTTTATTTTCTTGCTGGAAACTTGTGCTTGATAACTGGTGCGACACTGCTACTTGAGTAAAAAAAAAA
page-top