Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2244
Contig Information
Length 662 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 79 Clones [Download: CSV  ,  FASTA ]
whfl46i14    whfl4o10    whfl28c17    whfl24p19    whfl38b12    whfl7g09    whfl6h22    whfl34p09    whfl52o04    whfl46i16    whfl36j19    whfl17a19    whfl44b19    whfl55f14    whfl55f11    whfl29c17    whfl25b23    whfl3l15    whfl8j07    whfl3l04    whfl5l04    whfl48o13    whfl4l04    whfl7l04    whfl45c08    whfl17b02    whfl14o17    whfl54a11    whfl4g04    whfl4g15    whfl41p13    whfl51k13    whfl5i17    whfl4f20    whfl12g10    whfl40d02    whfl10a10    whfl48o14    whfl5e07    whfl8c24    whfl16l22    whfl32a24    whfl3o21    whfl38d05    whfl8e05    whfl41e06    whfl39k14    whfl51c13    whfl4h17    whfl50h16    whfl17p23    whfl19e07    whfl18j10    whfl28k12    whfl3l14    whfl33f18    whfl8e06    whfl32e10    whfl31i04    whfl47j24    whfl37c23    whfl43g03    whfl42e17    whfl42c20    whfl24i15    whfl29l10    whfl8a05    whfl34d11    whfl34g01    whfl43d01    whfl46e09    whfl46c23    whfl39l07    whfl2h21    whfl15d11    whfl9d03    whfl53c23    whfl16c23    whfl38o09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha tubulin-2A [Triticum aestivum] >gi|90289598|gb|ABD92931.1| alpha tubulin-2D [Triticum aestivum] >gi|90289600|gb|ABD92932.1| alpha tubulin-2B [Triticum aestivum]
Score 423
Evalue 1.25699e-70
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2244
tcATCGCTGTCTGGAACAGCGATGGCGCGAGAACCGAAGCAGAGTGGGGAAAGGCGTCTTCGTACTCGCCTCTCTCCGCGCAACCGAGCCTTCGCCCTCG
TCCTCCCCATTTCGCCAGCGGCGCAGCCCACCAACCACCCCCACCCGCCGCCATGAGGGAGTGCATCTCGATCCACATCGGCCAGGCCGGCATCCAGGTC
GGGAACGCGTGCTGGGAGCTCTACTGCCTCGAGCATGGCATTCAGCCTGATGGCCAGATGCCCGGTGACAAGACCGTTGGGGGAGGTGATGATGCTTTCA
ACACCTTCTTCAGCGAGACTGGTGCTGGGAAGCACGTCCCCCGTGCTGTCTTCGTAGATCTCGAGCCCACTGTGATTGATGAGGGTGAGGACTGGCGCTT
ACCGCCAGCTCTTCCACCCTG*AGCAGCTTATCAGTGGCAAGGAGGATGCAGCCAACAACTT*CGCCCGTGGTCATTACACCATTGGCAAGGAGATTGTT
GATCTCTGCCTTGATCGTATCAGGAAGCTTTCAGACAACTGCACTGGTCTGCAGGggaTTCCTTGTCTTCAACGCTGTTGGAAGGTGGAACTGGCTCTGG
CCTTGG*TTCGCTTCTCCTGGAGCGTCTCTCTGTTGACTATGgaaagaagtccnagcttggg
page-top