Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2674
Contig Information
Length 842 bp
Tissue Shoot grown under continuous light
Clones 14 Clones [Download: CSV  ,  FASTA ]
whkp2a07    whkp3a22    whkp3b24    whkp7b20    whkp15g02    whkp18a04    whkp18p19    rwhkp2a07    rwhkp3a22    rwhkp3b24    rwhkp7b20    rwhkp15g02    rwhkp18a04    rwhkp18p19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 800
Evalue 1.86962e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2674
CCGGCATCCTCCTCTCCTCCAGATAATACATTACCATGGCCCCCGCCGTGATGGCTTCCTCGGCTACCACCGTCGCACCCTTCCAGGGGCTCAAGTCCAC
AGCCGGTCTCCCCGTCGGCCGCCGCTCCAGCGGCAGCCTCAGCAGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCAATTGAGGGCATC
AAGAAGTTCGAGACCCTGTCTTACCTGCCACCCCTATCCACGGAGGCCCTCCTGAAACAGGTCGACTACCTGATCCGCTCAAAGTGGGTGCCCTGCCTCG
AGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCCCCGGGTACTACGACGGCCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGGTG
CACTGACGCCACACAGGTGCTGAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGTGTCATCGGCTTCGACAACCTGCGCCAGGTG
CAGTGCGTCAGCTTCATCGCCTTTAGGCCACCGGGTTGCGAGGAGTCCGGCAAGGCCTAAACTACGAGTTGAAACAATGGCCTATCTCGTATGAAGGTCT
TTTGTGAACTTCACTTTTGTCCAAAACTCTGCTGTACGACTCTGCTTTCTGACCGGAGCATACCTTTTGTTCTATATGATTTTGTGTATGTATGTACGAA
CATAGGTTCTTGAGCATGCATACGTAATTCCTCATAGGTCTATATCTTCTTCTTCGGCACAACCCCCGAATACATCAATGGACGAGATCTGTCTATACCT
TTTCATAATAAAGAGTAGGATGGTCTTTCAAGAAAAAAAAAA
page-top