Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2670
Contig Information
Length 1383 bp
Tissue Shoot grown under continuous light
Clones 13 Clones [Download: CSV  ,  FASTA ]
whkp10a11    whkp3h05    whkp16c17    whkp16h15    whkp16h16    whkp17e16    rwhkp10a11    rwhkp3h05    rwhkp16c17    rwhkp16h15    rwhkp16h16    rwhkp17e16    rwhkp17f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit geranylgeranyl hydrogenase [Triticum aestivum]
Score 1831
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2670
TGAGACATCATGAACAAAAACTTGAAGCCTTAGCTTATACTACAGTCATTCACATATCGAATATTGGCGTGCTTCAACAATCCAGACGAACTGCTCTGAA
GTCTGAACATCACCGTGCATGCGTACGTTGTACAAGAAAATCGGACAGGATCGACCAAGACACGACCTCTGGATCGACGCCATTACCTTATTCTCATCTC
CTCCGCCTCAAATCCGCTCGATCAGCCGCGGATCTCTGCTATACCGGTCGATCCGCCGCAGTTTCGAGCGACCCAAGCAGGATGTCAGGAACGTCCCGGC
GGGTCGGCGATCACAAGGTGAGCTTCCCCATCTCCCGGCGCAGCGCGGTGGCCCTGACGAGGCTGCCGATGGTGTTGACGGCGAGCTTGATGTCCTCGAT
GGGGTTGCCCGGCACGACGCGCTTGTAGAGGTAGCTGTCGAAGGTCATCCGCTGCACGTAGTCGTCGGCGCACATCTCCACGAACGCCTCCCGCGCCGCG
TTGGAGCGGTAGAACACCTTCTGCAGGATGTCCAGCACCTTGTACGTCGGCCAGTAGAGCCGGTCGAACTCCGCCAGGTACTTGCGCAGGTCGCTCTCGT
CCACCAGCCGCGTCCCGTTCGCCGACCCGGCCACGATCGCCTCCGCGCACATCCGCCCGCTCTTCGCCGCGAAGTAGATCCCCTCGCCGGAGCACTTTGT
CACGTACCCCGCCGCGTCGCCCACCAGCGTCACCCGCCCCGACACCCTTTTGGGCCTGGGGTGCTCGGGGATGGGGTGAGCCTCGACGCGGATGATCTTG
CCGCCCTCGATCTTGTCCTTGGCGCGGAGGCGGGTAGCGGCCTGGAACTTCTTGATGTCGGCCTTATGGGTGACGGTGCCGGTGCCGACGGCGACGTGGT
CACACTTGGGGAACACCCAGCCGTAGAAGTCGGGGGACACGTCGTCGCCGACGTACATCTCGGCGCGCTCCTCGTAGTAGCGCATCTTGTCGTCGGGGAT
CTTGACGCGCTCCTGGAACGCGATGGCGTACTCGTAGTCGCCGGCGCCCATGTCCTTGGCCACGCGGGAGTTGGCGCCGTCCGCGCCCACGATCGCGTCC
ACCTCGAACGAGCGCTTCTCGCCGCCCACCTTGCCGTTGGAGCTGTCGTAGTGGTTGTAGTGCACCGTGTATGTGCCGTTGCGCTCCTTGGGCGCCTCAT
ACCTTAGGAAGAGGCCGTTAAGGACCTCGGCGCCGGCCTTNTGAGCCCGGGTACGGAGGAAGTCGTCGAGCACCTCGCGTCTGACCATGCCAATGTACTC
GTGCGGCGCGAGCGTGCGGCCGATGTCGACGGCGACGTTGGAGGGCGAAATCATCTTCATCTTGGTGACCCTCCTGTCGACGA
page-top