Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2669
Contig Information
Length 584 bp
Tissue Shoot grown under continuous light
Clones 13 Clones [Download: CSV  ,  FASTA ]
whkp10e04    whkp5h06    whkp14d03    whkp15m02    whkp19g08    whkp19l14    rwhkp10e04    rwhkp2g16    rwhkp5h06    rwhkp14d03    rwhkp15m02    rwhkp19g08    rwhkp19l14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Metallothionein-like protein 1; Short=MT-1 >gi|170787|gb|AAA50846.1| metallothionein-like protein >gi|51243716|gb|AAT99562.1| metallothionein [Triticum aestivum] >gi|51243718|gb|AAT99563.1| metallothionein [Triticum turgidum subsp. durum] >gi|51243720|gb|AAT99564.1| metallothionein [Triticum turgidum subsp. durum] >gi|51243722|gb|AAT99565.1| metallothionein [Triticum aestivum] >gi|51243724|gb|AAT99566.1| metallothionein [Triticum turgidum subsp. durum]
Score 172
Evalue 5.68724e-11
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2669
TTTTTTTTTTGGTAACTGAAGTAGCGATTTAGGACTAGTTAATTAGGTAAATCTTTCATTCTTACATATTCATCACTCCATCCATAGTGGAGATAGATGA
AGCAATTACAGGGAGACATGCGCACACACATACACACAAGGACACCATGGGCAGAGCATAGGCGGAGAGCGAGCAAGCAAATCACACGCACACGCACCCT
TGCTCGACTCCATCAGATCAGACGCTCGTTATTCAAGTATACTCTCACACCATCACACGTACGTACGTACGAGTGCATGCAGCTTAACAGTTGCAGGGGT
TGCACTTGCAGTTGTCGCCGCAGCTGCAGCCCTCGCCGGACTGCCCGGCGGCCACCTCGAACTGCCCCGCCTTGTTCTCAGGAGCCACGCCGAGCACGAC
CACGGCGGCGACCTGGGCGGCGGCGCTGCCCTGCTCTGTCAGATCAGGGTACATCTTCCCGCACTTGCAGTCTGAGCCGCAGCTGCAACCGGATCCACAG
TTGCAAGACATCCTCCAAATCTGTGAACCCAAAAAGATTTCAAGGAGAAGAAGATGGGCTTTGGTATCGGGGATGATGATGAGC
page-top