Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2664
Contig Information
Length 1621 bp
Tissue Shoot grown under continuous light
Clones 12 Clones [Download: CSV  ,  FASTA ]
whkp10e07    whkp10f22    whkp1m12    whkp5m08    whkp8n15    whkp20j18    rwhkp10e07    rwhkp10f22    rwhkp1m12    rwhkp5m08    rwhkp8n15    rwhkp20j18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha tubulin-2A [Triticum aestivum] >gi|90289598|gb|ABD92931.1| alpha tubulin-2D [Triticum aestivum] >gi|90289600|gb|ABD92932.1| alpha tubulin-2B [Triticum aestivum]
Score 2174
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2664
GTGCATAACAGGTTCAAACATACAAGGTTCTTACAACACAACAGGTTGTAAAACAAACACCACAAAGCAAATGTTCAAACAGACAGATAACAGATAAAGC
CACTCGGGCAGATCATAGGATTGCAGCAGCATGCCTTGGGAAAGCACCAGGAGGCAGGCTCTAGTACTCATCGCCCTCGTCACCGTCCTCACCCTCGTCG
AACTCAGCACCAACTTCTTCGTAGTCCTTCTCCAGGGCAGCAAGATCCTCACGGGCCTCAGAGAACTCTCCCTCCTCCATGCCCTCACCCACGTACCAGT
GGACGAAGGCACGCTTGGCGTACATCAGGTCAAACTTGTGGTCGATGCGGGAAAAGACCTCGACAACACTGGTGGAGTTGGAGATCATGCACACAGCCCT
CTGGACCTTGGCAAGGTCACCGCCTGGGACGACACCAGGTGGCTGGTAGTTGATACCACACTTGAAGCCAGTGGGGCACCAGTCAACAAACTGGATAGTG
CGCTTGGTCTTGATGGTGGCCACAGCAGCGTTGACATCCTTGGGCACAACATCACCACGGTACATGAGGCAGCAGGCCATGTACTTGCCATGGCGGGGGT
CGCACTTGGCCATCATGGAGGAAGGCTCAAAGGCGCTGTTGGTGATCTCGGCAACAGACAGCTGCTCATGGTAGGCCTTCTCGGCTGAGATCACTGGGGC
ATAGGAGGAAAGCATGAAGTGGATCCTCGGGTAGGGCACCAGGTTGGTCTGGAACTCGTTGACATCAACATTCAGAGCACCATCAAACCTCAGGGAAGCA
GTCAATGATGAAATGACCTGAGAAACAAGCCTGTTGAGGTTGGTGTATGTTGGGCGCTCAATGTCAAGGGAGCGGCGGCAGATGTCATAGATGGCCTCAT
TGTCAAGAAGGATAGAGACATCGGTGTGCTCAAGGAGTGAGTGGGTGGACAGGACACTGTTGTATGGCTCAACAACAGAAGTGGAGACCTGGGGAGATGG
GTAAACTGTGAACCCAAGCTTGGACTTCTTTCCATAGTCAACAGAGAGACGCTCCAGGAGAAGCGAACCAAGGCCAGAGCCAGTTCCACCTCCAACAGCG
TTGAAGACAAGGAATCCCTGCAGACCAGTGCAGTTGTCTGAAAGCTTCCTGATACGATCTAGGCAGAGATCAACAATCTCCTTGCCAATGGTGTAATGAC
CACGGGCGAAGTTGTTGGCTGCATCCTCCTTGCCACTGATAAGCTGCTCAGGGTGGAAGAGCTGGCGGTAAGCGCCAGTCCTCACCTCATCAATCACAGT
GGGCTCGAGATCTACGAAGACAGCACGGGGGACGTGCTTCCCAGCACCAGTCTCGCTGAAGAAGGTGTTGAAAGCATCATCACCTCCCCCAACGGTCTTG
TCACCGGGCATCTGGCCATCAGGCTGAATGCCATGCTCGAGGCAATAGAGCTCCCAGCACGCGTTCCCGACCTGGATGCCGGCCTGGCCGATGTGGATCG
AGATGCACTCCCTCATGGCGGCGGGTGGGGGTGGTTGGTGGGCTGCGCCGCTGGCGAAATGGGGAAGGAGGAGGGCGAAGGCTCGGTTGCGCGGAGAGAG
GCGAGTACGAAGACGCCTTCC
page-top