Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2241
Contig Information
Length 600 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 68 Clones [Download: CSV  ,  FASTA ]
whfl9o24    whfl43a18    whfl6k24    whfl11f01    whfl48e08    whfl51k21    whfl42l20    whfl13m14    whfl3a03    whfl29n24    whfl41d06    whfl5g15    whfl9m04    whfl32l10    whfl44j07    whfl20i07    whfl19j20    whfl19i19    whfl29h12    whfl15k19    whfl15k08    whfl5a08    whfl8e18    whfl1f15    whfl7m06    whfl13p10    whfl32m08    whfl32n11    whfl17l23    whfl48k10    whfl20c15    whfl6d01    whfl30l12    whfl55b08    whfl50o17    whfl38m20    whfl2k16    whfl51e22    whfl10k08    whfl30p16    whfl50h10    whfl10k07    whfl26n21    whfl41d11    whfl4l20    whfl48p05    whfl50o06    whfl46p16    whfl25g09    whfl38n12    whfl7m16    whfl40o11    whfl18o15    whfl7h01    whfl10f13    whfl34h13    whfl8h09    whfl39n12    whfl53c12    whfl39o11    whfl7g14    whfl9b22    whfl2f22    whfl53h05    whfl32n12    whfl45p05    whfl18o16    whfl25g10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 919
Evalue 1.46898e-97
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2241
tcATGCTCTCAGTCCCCCCATCCCCGCCGCCGCCTCCTCTCGGTTCCTTCTCCTTCCTCGGAGCTTCAGCCATGGGTAAAGAGAAGACTCACATCAACAT
CGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCATCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAG
AAGGAAGCCGCCGAGATGAACAAGAGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTGAAGGCCGAGCGTGAGAGGGGTATCACCATTGATATTGCCC
TGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCTCCTGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGA
CTGTGCTGTGCTCATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTCCTTGCTTTCACTCTT
GGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGATGCCACCACTCCCAAGTACTCAAAGGCCCGTTATGaggaaattgtcaaggaagtctcttcgt
page-top