Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2654
Contig Information
Length 1020 bp
Tissue Shoot grown under continuous light
Clones 11 Clones [Download: CSV  ,  FASTA ]
whkp10c03    whkp10c04    whkp1j09    whkp19a18    whkp19b05    rwhkp10c03    rwhkp10c04    rwhkp1j09    rwhkp9l09    rwhkp19a18    rwhkp19b05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0595400 [Oryza sativa (japonica cultivar-group)] >gi|55733879|gb|AAV59386.1| putative nucleoside diphosphate kinase [Oryza sativa (japonica cultivar-group)] >gi|57900667|gb|AAW57792.1| putative nucleoside diphosphate kinase [Oryza sativa (japonica cultivar-group)] >gi|113580066|dbj|BAF18429.1| Os05g0595400 [Oryza sativa (japonica cultivar-group)] >gi|215692731|dbj|BAG88151.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215694755|dbj|BAG89946.1| unnamed protein product [Oryza sativa Japonica Group]
Score 891
Evalue 7.20912e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2654
TTTTTTTTTTGCAGAGAATATAGGCCTGAATTTGGACAACACATGAAAACAAACAGCATCCATCAAAATCAAGTGCCTGAAGGCGACGGTTTGATTTGAA
CATCACGATTGCTCGGTGCACGCTCTATAATATTCAAAGGTACAAGCTCTTTAAATTTCTTCGGGCCCTATTGCATCAGAACGAGACAAGGGCAAGGGCG
ACACCGACTGAAAGGTCGCCCGGGTCGCGGTGTTATTGCACTCTGCCATGGTCTAGACGCGATTACGGAAAGGGACTGGAGCTTCTTTGGCTCTTCTGAA
GACGATGCAGCGGTTAGTTCACACCGTAGATCCACTTCTCCTCGTTGCTGGTGTAAGAGACCAGCTCCTTGGGCTGGAACCAGAGTGCGATCTCGTCCTT
GGCTGTCTCCGGGCCATCGCTCCCATGGATGATGTTTCTTCCAACAACAACAGCAAGGTCACCCCTGATGGTTCCTGGCTCAGATTTCGATGGGTCCGTG
GCACCGATCAGCTTCCTCCCGTACTTGATAACGCCCTCTCCTTCCCATACCATGGCAAGCACGGGACCGGAGCTGAGGAAGTCGCACAGTCCACTGAAGA
AAGGTCTTTCCTTGAGATCATGGTAGTGCTTCTCGGCAAACTGCTTGGATGGAACCACCAGCTTGATGGCAACAAGCTTGTATCCTTTTCTCTCGAATCG
GGACACTATCTCAGAAATGAGGCCTCTCTGGACGCCGTCGGGCTTGATGGCGATGAAGGTGCGCTCCATCTCGGCGGCATGCACGTCCTGATCCTGGAGC
ATGTAGGCTGCGGCGGGGATGGCGGCGATCCATGCGTAGCCGTGGGAGGAGGCGTTGGTGTGGAGGTGGTGGGCGTATGCGGCGGGGAGGGTGGAGTTCC
TGCCGAGGTTGGCGAGGGTGGCGAGCGCGGCGTTCCTCCCGTCTGCGAGGAGGGAGGAGGCCGGAGCGGAGGAGGATGCGATCAAGGACCTGGCGGCCTT
GCAGGCGGAGTGGAAGAGCT
page-top