Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2625
Contig Information
Length 1252 bp
Tissue Shoot grown under continuous light
Clones 9 Clones [Download: CSV  ,  FASTA ]
whkp1c24    whkp1d11    whkp3e20    whkp20c15    whkp20p11    rwhkp1c24    rwhkp1d11    rwhkp3e20    rwhkp20c15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit malate dehydrogenase [Plantago major]
Score 893
Evalue 1.02594e-157
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2625
CCCCCGGGCTCCAATGGCGGCGAAGGAACCGATGCGCGTGCTCGTCACCGGCGCCGCAGGACAAATCGGATATGCTCTTGTTCCCATGATTGCCAGGGGA
GTTATGCTTGGTGCAGACCAGCCTGTTATTCTGCATATGCTGGATATTGAATTTGCTGCTGAAGCTCTTAAAGGCGTCAAGATGGAGTTGATCGATGCCG
CATTTCCACTTCTCAAGGGAGTTGTTGCAACAACTGATGTTGTTGAGGCTTGCACTGGTGTGAATGTTGCGGTTATGGTTGGTGGATTCCCCAGGAAGGA
AGGAATGGAAAGGAAGGATGTTATGACGAAAAATGTTTCAATCTACAAAGCTCAAGCATCTGCTCTTGAAGCTCATGCAGCCCCCAATTGCAAGGTTTTG
GTTGTTGCCAACCCCAGCAAACACCAATGCTCTCATCCTGAAGGAGTTTGCTCCATCTATCCCTGAGAAGAACATCAGTTGTTTGACCCGCCTAGACCAC
AACAGGGCACTCGGTCAGATTTCTGAGAGACTTGGTGTCCAAGTTTCTGACGTTAAGAATGCTATTATCTGGGGTAATCACTCGTCCAGTCAGTATCCTG
ATGTTAACCATGCCACTGTGAAGACTCCCAGTGGAGAGAAGCCTGTTCGTGAACTTGTTCAAGATGATGAATGGCTAAATGGGGAGTTCATTGCCACTGT
CCAGCAGCGTGGTGCTGCAATCATCAAAGCGAGGAAGCTCTCCAGTGCTCTCTCTGCTGCCAGCTCAGCTTGTGATCACATCCGTGACTGGGTTCTGGGA
ACCGCTGAGGGAACATTTGTTTCCATGGGTGTGTACTCTGATGGTTCATACGGTGTGCCTGCTGGTCTTATCTACTCCTTCCCAGTAACGTGCAGTGGTG
GTGAATGGACAATTGTTCAAGGGCTCCCGATCGATGAGTTCTCGAGGAAGAAGATGGATGCGACCGCCCAGGAGCTGTCAGAGGAGAAGGCGTTGGCCTA
CTCATGCCTGGCGTAAATCCACATTCGAAGGGCAGCTGCTCCTCTGGATGTTTTGAATAAATGAAACCTTCCGCTCTTTAGAAACTCTCGTCTCCACCCA
GAACAGCCGCACATCGCGATGCATGCTCCTTTTCGCTGGTTTTCCAAGTGTGTATGAATGAGGCTTGTAGCTCCCCTTTTGCCTGATGATTTACAGGACA
GTACATTTGCTGCAAGAGTGAAACAATTTGACACCTGATTAGAAAAAAAAAA
page-top