Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2620
Contig Information
Length 1598 bp
Tissue Shoot grown under continuous light
Clones 9 Clones [Download: CSV  ,  FASTA ]
whkp10i04    whkp2g20    whkp7m20    whkp20h09    whkp20m15    rwhkp2b11    rwhkp2g20    rwhkp7m20    rwhkp20m15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Tubulin alpha-3 chain >gi|4165488|emb|CAA10663.1| alpha-tubulin 3 [Hordeum vulgare subsp. vulgare] >gi|90289602|gb|ABD92933.1| alpha tubulin-3B [Triticum aestivum] >gi|90289604|gb|ABD92934.1| alpha tubulin-3A [Triticum aestivum] >gi|90289606|gb|ABD92935.1| alpha tubulin-3D [Triticum aestivum]
Score 2163
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2620
GGCGTCTTCGTACTCGCCTCTCTCTCGCGCTTCCGAGCTTTGGCCTCCCTCCCCTCCTCCCCGCAATCTCCCCACCAGCGTAGCGCAGCGCGCGCCTCCG
CCGCTCCGACCCGCAGCCATGAGGGAGTGCATCTCGATCCACATCGGCCAGGCCGGCATCCAGGTCGGGAACGCGTGCTGGGAGCTCTACTGCCTCGAGC
ATGGCATTCAGCCTGATGGACAGATGCCTGGTGACAAGACCGTTGGGGGAGGTGATGATGCTTTCAACACCTTCTTCAGTGAGACTGGTGCTGGGAAGCA
TGTTCCCCGTGCTGTCTTTGTTGATCTTGAGCCCACTGTGATTGATGAGGTGAGGACTGGCACCTATCGCCAGCTCTTCCACCCTGAGCAGCTTATCAGT
GGCAAGGAGGATGCAGCCAACAACTTTGCCCGTGGTCACTACACCATTGGCAAGGAGATTGTTGACCTATGCCTTGACCGTATCAGGAAGCTTGCAGACA
ACTGCACTGGTCTCCAGGGATTCCTTGTCTTCAACGCTGTTGGAGGTGGAACTGGCTCTGGCCTTGGTTCTCTCCTCCTTGAGCGTCTCTCTGTTGACTA
TGGAAAGAAGTCCAAGCTTGGGTTCACAGTGTACCCATCTCCTCAGGTCTCCACCTCTGTTGTTGAGCCATACAACAGTGTCCTGTCCACCCACTCTCTC
CTTGAGCACACTGATGTGGCTGTCCTTCTTGACAATGAGGCCATCTATGACATCTGCCGCCGCTCCCTTGACATTGAGCGCCCAACATACACCAACCTCA
ACAGGCTCGTTTCTCAGGTCATCTCATCCCTGACTGCTTCCCTGAGGTTTGATGGTGCTCTGAATGTTGATGTCAACGAGTTCCAGACCAACCTGGTGCC
CTACCCAAGAATCCACTTCATGCTTTCCTCCTACGCCCCAGTGATCTCAGCCGAGAAGGCTTACCATGAGCAGCTCTCTGTTGCCGAGATCACCAACAGC
GCCTTCGAGCCTTCCTCCATGATGGCAAAGTGTGACCCCCGCCACGGCAAGTACATGGCCTGCTGCCTCATGTACCGTGGTGATGTTGTGCCCAAGGATG
TCAACGCCGCTGTGGCCACCATCAAGACGAAGCGCACCATCCAGTTTGTGGACTGGTGCCCCACTGGTTTCAAGTGTGGTATCAACTACCAGCCACCCAG
CGTCGTCCCAGGCGGCGACCTTGCCAAGGTCCAGAGGGCCGTCTGCATGATCTCCAACTCCACCAGCGTTGTCGAGGTCTTCTCCCGCATCGACCACAAG
TTCGACCTGATGTACGCCAAGCGTGCCTTCGTCCACTGGTACGTGGGTGAGGGCATGGAGGAGGGAGAGTTCTCTGAGGCCCGTGAGGATCTCGCTGCCC
TGGAGAAGGACTATGAAGAAGTTGGTGCTGAGTTCGACGAGGGTGAGGATGGTGATGAGGGTGATGAGTACTAGAGCAGCTGAGATTGCGACCTGATGAT
CTGCCCGAGTGGCTTTATCTGTTTTCTGTCTGTTTGAATTGAATGTTTGCTGTGGGGTGTTTGGTTTACAACCTGTTGTGTTGTATGAACCTGCTCGC
page-top