Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2581
Contig Information
Length 928 bp
Tissue Shoot grown under continuous light
Clones 8 Clones [Download: CSV  ,  FASTA ]
whkp10a19    whkp9d03    whkp9d04    whkp17i21    rwhkp10a19    rwhkp9d03    rwhkp9d04    rwhkp17i21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit USP family protein [Triticum aestivum]
Score 681
Evalue 1.39397e-69
Total Hit Count 142
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2581
AATATCCTCTGGCCGACAAGAGAAGGCCACCACCGTCGTCGTCGTCCTTAATTGTTCCTGCGTCTCCCAACTTTTCCTTCCAAACAGCGGTGACCTCCAC
CACCACCCAAGAGCCGAGCGAGGAGAAGAGAAGAGATCGGCCATGGCTGCGGACGGCGAGAGGTGGGTGGGCCTGGCGGTGGACTTCTCGGAGGGGAGCC
GCGCGGCGCTGCAGTGGGCGGCGGACAACCTGCTCCGCTCCGGCGACAACCTGCTCCTCCTGCACGTCCTCAAGGACCCCGACTACGAGCAGGGCGAGAC
CCTCCTCTGGGAGGCCTCCGGCTCGCCTTTGATCCCCCTCTCGGAGTTCTCTCACCCTTCAACTGCAAAGAAATATGGGGTGAAGCCTGATGCTGAAACG
CTGGACATGCTCAACACTATAGCTAAGCAGAAGGAGGTCTCCGTGGTTTCAAAAGTCCTGTTTGGAGATCCCCGCGAGAAGCTGTGCCAAGCCATCCATG
ACATGCCCATCAGCTCCCTGGTCATTGGGAGCAGGGGCCTTGGCAAGCTCAAGAGGGTGCTCTTGGGCAGCGTCAGCGATTACGTCGTGAACAATGCCGC
CTGCCCTGTCACCGTTGTCAAGCCAGCGAGTAACCATGCCTGATCTCATCATCGCAAATGTCCACATGTGTTTTAGTTTGCCAGAGTCCTATATATCCAG
TTGGCCGCAACTTATTGAACCATCCAGTGTTATTTGTAATAATAATTGACAATTAGCCTGTGGATGATTCCCAGGTGTGTGTAATCTGTGCATGTGTCCT
GTACATCCTGTACATTTGTGTGCTTATCTTCAGCCTAGCTTTTGCTCCATGAGTCAGTCCGTGCTGCTGTTTGTTGCATACAGTTTGTAGAGTCTGAATA
AAATGGATTCTGCTGTCCAAAAAAAAAA
page-top