Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2570
Contig Information
Length 1577 bp
Tissue Shoot grown under continuous light
Clones 7 Clones [Download: CSV  ,  FASTA ]
whkp1f19    whkp1p09    whkp1p10    whkp6p21    rwhkp1p09    rwhkp1p10    rwhkp6p21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2262
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2570
CGCCGCCGCCGCCTCCTCGTCCTCTCGGTCCCCTCTCCTTCCTTCGAGTTTGCTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTG
GCCACGTCGACTCTGGCAAGTCGACGACCACTGGCCACCTGATCTACAAGCTTGGAGGCATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAAGCCGC
TGAAATGAACAAGAGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGAGAGGTATCACCATCGATATTGCCCTCTGGAAGTTT
GAGACAACCAAGTACTACTGCACCGTCATTGATGCCCCTGGTCACCGTGACTTCATCAAGAACATGATCACCGGTACCTCCCAGGCTGACTGTGCTGTTC
TCATCATCGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACACGTGAGCACGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCA
GATGATCTGCTGCTGCAACAAGATGGACGCCACCACTCCCAAGTACTCGAAGGCTCGTTACGAAGAAATTGTTAAGGAGGTCTCTTCGTACCTGAAGAAG
GTCGGCTACAACCCTGACAAGGTTCCCTTCGTCCCCATCTCTGGGTTCGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGACTGGTACAAGGGCC
CAACCCTTCTTGAGGCGCTTGACCAGATCAACGAGCCCAAGAGGCCCTCAGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTTTACAAGATTGGTGGCAT
TGGAACTGTGCCTGTTGGCCGTGTTGAGACTGGTGTCATCAAGCCTGGTATGGTTGTCACCTTTGGTCCCACTGGTCTGACAACTGAGGTCAAGTCCGTT
GAGATGCACCATGAGTCTCTCCTGGAGGCGCTTCCTGGTGACAACGTTGGCTTCAATGTCAAGAATGTTGCCGTGAAGGATCTGAAGCGTGGTTTTGTTG
CATCCAACTCCAAGGATGACCCTGCCAAGGAGGCAGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTCAGATTGGCAACGGCTACGCCCC
AGTGCTGGACTGCCACACCTCGCACATTGCTGTCAAGTTTGCTGAGCTGGTGACCAAGATCGACAGGCGATCTGGTAAGGAGCTGGAGGCCCTGCCCAAG
TTCCTCAAGAATGGTGATGCTGGCATAGTGAAGATGATTCCCACCAAGCCCATGGTTGTGGAGACCTTTGCTACTTACCCACCTCTTGGTCGTTTTGCTG
TCCGTGACATGAGGCAAACTGTGGCTGTTGGTGTCATCAAGGGTGTGGAGAAGAAGGACCCAACCGGCGCCAAGGTGACCAAGGCTGCCATCAAGAAGAA
ATGAGGCGTTTACCTGAATCCATCTATGTCTGCTTTTGAGATCTCTAGTAGTTTAGTGCCTATTAAGTTTTGCTACTGTTAGCGCCGTGTGATATGCGCC
CTGTTGATGTGTCATTTGAGTACTGTCGTTAATTTTGGCTTTTGGCAAAACATGGAAGCTTCTGAGACTACTCATTT
page-top