Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2232
Contig Information
Length 965 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 58 Clones [Download: CSV  ,  FASTA ]
rwhfl53l17    rwhfl4j10    rwhfl28j07    rwhfl25i07    rwhfl26i07    rwhfl48o11    rwhfl9b02    rwhfl47h19    rwhfl51o05    rwhfl52o07    rwhfl51o07    rwhfl16b19    rwhfl53e17    rwhfl16b20    rwhfl8a10    rwhfl52o06    rwhfl9b13    rwhfl52o13    rwhfl45i06    rwhfl26d16    rwhfl17f15    rwhfl54a06    rwhfl12o10    rwhfl40k02    rwhfl10b12    rwhfl27b12    rwhfl43p11    rwhfl33c18    rwhfl28b12    rwhfl40d14    rwhfl22d15    rwhfl16a19    whfl53l17    whfl17f15    whfl40k02    whfl52o06    whfl33c18    whfl8a10    whfl54a06    whfl48o11    whfl53e17    whfl43p11    whfl4j10    whfl51o05    whfl12o10    whfl47h19    whfl28b12    whfl16b20    whfl28j07    whfl16b19    whfl25i07    whfl45i06    whfl9b13    whfl52o13    whfl9b02    whfl10b12    whfl17a07    whfl26i07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 813
Evalue 7.16671e-85
Total Hit Count 394
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2232
ctgaaagatgaaaatACTGCAAGGTAGAACACATAATAGAATCTGGATAGCTTTAGATCACAACCAAAACAGGCAAAACATTCTCAGTTCAACCTAGGAC
TCGAACCGTTTACAGAAAATGGTGTTCAGTATGTCTGCAAACATGACATGG*ACGCAACATCTAAGAAAATCCAACGAGTAACATGCAGCAGCTCTTCAG
CCTAAGCTGTG*GCACCCTTGCCCTTCTTCTTCTGGAGCTTCCTCATGTAGAACTCCAggcTCCTTGCCCTCCAGGATGTACCCATCAGCTCTGCCACAC
TGTCCAGGGCGAGACGAAATGCAGGCCAGCAGCCTTCCACCACTGAACTGCTCCTCAATGTGCGAGTCCAGTGTACGTCCCTGCTGGCGCTTCTCAAGCT
TCCTCTGGACATTGTTGCTCTTCTTTGCTTCCTCTGTGGCAGCAGCAGCAACCTCAGCCTCTTGCCCCTCAGCAGGTTCCTTCTTGGCAGCTGCAGCAGC
TTTCTTCTTCCTACCGATTTCGACTCCATAATGAGTCAGGTACCACTGCTTGAAGGGGGCAGCATCAACTTGCACAATGGCATTCTTGACAAGGGTCTGA
GTCCTCACAAGCTCATTGTTTGACGAATTGTAAACCACATCCAGGAGACGGG*TCTTG*CGGG*TCACAGCC*TCACT*ACCCCATGAGAAGTTACCAGT
GTCAAGACGGAGAGCCCTCCACTTCACGTTACCTCCGCGAACACGGACCCTCCTCACTGTCTTGTTGCTTGAAAGCTTAGTG*TTGGCTGGCTGGCGGCC
GAGCTCATACTTTCGCTTCTTCCTCCAAGCCTTCTGCTT*CCCACCGGTGGCCCGGCG*CTTGTGCATGGAGTCACGCGAGATACCCATGGTGGCGTCGG
CGGCTTGGTTCCGCTGCTGATTCGCCTCCTATGCGCGCGCCGCCGCAGCTTTGGTTTGGTCTCgc
page-top