Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2579
Contig Information
Length 1340 bp
Tissue Shoot grown under continuous light
Clones 7 Clones [Download: CSV  ,  FASTA ]
whkp6n01    whkp8m03    whkp17l22    rwhkp6n01    rwhkp8m03    rwhkp8m16    rwhkp17l22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cysteine synthase; AltName: Full=O-acetylserine sulfhydrylase; AltName: Full=CSase A; AltName: Full=O-acetylserine (Thiol)-lyase; Short=OAS-TL A >gi|218335|dbj|BAA02438.1| O-acetylserine (thiol) lyase [Triticum aestivum]
Score 1514
Evalue 6.1596e-166
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2579
TTTTTTTTTTAAGGGCACCATGATGCTTTATTTCACACTGGCTGACATATGGACCACAGAGGAATAGTTCAATATACAGGGCAGGCAAGAAGTAATTCAA
ACTGCTAAACACCACAAGGCCAACACAAAGTATTCCCCATTGCTACACAAAGTGGGATTAAAGCTTGACAGGGCTTGATGTCAGACCAACACTAGCAGGG
ACGCCAAAGCTTTTATTTCTGTAAGGAGGGCTCCTACGAATGGAGGGATTTGGCTTTGGAGAACAGCTTCGCGCGCTTGAGGAGTCCCGAGGGTCACTCG
ACCACCATGCTCTCGGCCTCCTTCTTGATGGAGTGGAAGAGCACCGACGAAAGGTAGCGCTCTCCGAAGCTTGGGAATACAACAACAAAGAGTTTCCCTG
CATTTTCAGGCCTCTGAGCAACCTTGATTGCAGCTGCTGCAGCAGCACCAGAAGAGATTCCAACCAGCAATCCTTCTTTCAATGCCAGAGACTTTGCCAT
CTCAATGGACTCATCACTTGAAACCTGTATGGTTTCATCAATGATGTCAACATCCAAGACACCAGGGATAAAACCAGCTCCAATTCCTTGGATCTTGTGT
GGTCCAGGCTTTCCACCATTTAAGACAGCACTCTCGGTAGGCTCCACACCGTAGAGCTTGATGTTAGGATTTTGCTCTTTGAGGTATTTTCCAGATCCAG
TAATGGTACCACCTGTCCCGATGCCAGAAACAAGGCCATCGATCTTTCCTCCTGTGCCTTTCCAGATTTCAGGCCCAGTTGTCTCATAGTGAATCTTTGG
GTTGGCAGCATTCTCGAACTGCTGAAGGATGTATGAGTTAGGTGTCTTTGCTGCCAGCTCTTCCGCCTTTTGGACAGCTCCTTTCATTCCCAAGAGTGGG
TCGGTGAGGACCAGCTCAGCACCAAAAGCCTTCAAGATGATTCTCCTCTCCATACTCATGGATGCGGGCATTGTGAGTACAAGTCTGTAACCCTTGGCAG
CAGCCATGAAGGCCAGCCCAATGCCTGTGTTGCCACTGGTTGGCTCAATCAGGACACTCTTGCCTGGGACGATGAACCCCTTCTCCTCCGCGTCGGTGAT
CATGCTGTATCCAATCCTGTCCTTGACGCTGGAGCAGGGCTCCATGGACTCGAGCTTGGCGGCGACGCGCCCCACGCACCCGTCGGTCACCTTGTTGAGG
TACACCAGCGGCGTGTTCCCGATCAGCTCGGTGACATCCTTGGCGATCGCCGGAGATGACGCCTCCCCCATCCCGCCGTCGACGAGCGATTTGACAGCGA
AGTGATCCTTCTGGAGCCGGAGCTGGACGAAGTGGCGGCC
page-top