Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2551
Contig Information
Length 1691 bp
Tissue Shoot grown under continuous light
Clones 7 Clones [Download: CSV  ,  FASTA ]
whkp11a07    whkp5e18    whkp6m08    whkp7i10    whkp15g13    rwhkp11a07    rwhkp7i10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|396134|emb|CAA80666.1| protein synthesis elongation factor-1 alpha [Hordeum vulgare subsp. vulgare]
Score 2236
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2551
CGCCGCAGGCTTTGACCCCATCGCCCCTCCGTCCTCTTCGTCTCCGGTAGGCCAGGTAGTTAACAGCTCCAGCAGCCATGGGAAAGGAGAAGATCCACAT
CAGCATTGTGGTCATTGGCCATGTCGACTCTGGCAAGTCAACCACGACTGGCCACCTCATCTACAAGCTTGGAGGCATTGACAAGCGTGTGATTGAGAGG
TTTGAGAAGGAAGCCGCTGAGATGAACAAGAGGTCTTTCAAGTATGCCTGGGTGCTTGACAAGCTCAAGGCTGAGCGTGAGAGGGGTATCACCATTGATA
TTGCTCTGTGGAAATTCGAGACCACCAAGTACTCCTGCACTGTCATTGATGCTCCTGGTCACCGTGATTTCATCAAGAACATGATCACCGGGACCTCCCA
GGCTGATTGTGCTGTGCTTATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTTGCTTTC
ACTCTTGGTGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGATGCCACCACTCCCAAGTACTCGAAGGCCCGTTATGAAGAAATTGTCAAGGAAGTCT
CTTCATACCTGAAGAAGGTTGGTTACAACCCTGACAAGGTTCCCTTTGTTCCCATCTCTGGGTTCGAGGGTGACAACATGATTGAGAGGTCCACCAACCT
TGACTGGTACAAGGGCCCCACCCTTCTCGAGGCCCTGGACCAGATCAATGAGCCCAAGAGGCCCTCAGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTG
TACAAGATTGGCGGCATTGGAACTGTGCCAGTGGGGCGTGTTGAGACTGGAGTCATCAAGCCAGGCATGGTTGTCACCTTTGGTCCTACTGGCCTGACCA
CTGAGGTGAAGTCTGTGGAGATGCACCACGAGTCTCTCCTGGAGGCGCTTCCTGGTGATAATGTCGGCTTCAACGTCAAGAATGTGGCTGTCAAGGATCT
CAAGCGTGGGTACGTGGCCTCTAACTCCAAGGACGACCCCGCCAAGGAGGCTGCCAACTTCACCGCCCAGGTCATCATCATGAACCACCCCGGCCAGATC
AGCAACGGCTACGCCCCGGTGCTGGACTGCCACACGTCCCACATCGCTGTCAAGTTCGCTGAGATCCAGACCAAGATCGACCGGCGGTCTGGCAAGGAGA
TTGAGGCGGCGCCCAAGTTCCTCAAGAACGGTGATGCCGGGTTCGTCAAGATGATCCCCACCAAGCCCATGGTGGTGGAGACCTTCGCCCAGTACCCTCC
CCTGGGTCGCTTTGCTGTGCGTGACATGAGGCAGACGGTCGCCGTTGGCGTGATCAAGAGCGTGGAGAAGAAGGATCCGACCGGCGCCAAGGTGACCAAG
GCTGCGGCCAAGAAGAAATGAGATGGTGTCGGGCGGTGGCGTTGTTGGTGGTTCTTTACCACATCTATGGTGGTGGTGGCGGTATACGGTGGTGGTGATA
GTCGTGTTAGCCGATTTGCGAACTTGTTAAGCTTTGGTTATTTGTGTCGAGCAGTGTTCGAACTGCTTATTACTGTGGTCATAGTATCGTTCGGTTGTGT
TGGTGAAACTTCGTCAGATAAAGTTGCTATTTTATATTTGAGTGATATTTGGANTCNTTTTATATCTGCTGCCTGTANCATAAAAAAAAAA
page-top