Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2229
Contig Information
Length 874 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 52 Clones [Download: CSV  ,  FASTA ]
rwhfl5p12    rwhfl4a15    rwhfl16m14    rwhfl14l24    rwhfl38n07    rwhfl9m17    rwhfl39p01    rwhfl46a03    rwhfl44g06    rwhfl8o18    rwhfl50f18    rwhfl48n18    rwhfl42p24    rwhfl51i16    rwhfl55l02    rwhfl15o03    rwhfl31i08    rwhfl10b13    rwhfl42i09    rwhfl14d07    rwhfl15k11    rwhfl24a13    rwhfl55p12    rwhfl38n08    rwhfl26e05    rwhfl23a13    rwhfl15n24    whfl32e04    whfl50f18    whfl55l02    whfl46a03    whfl15e05    whfl44g06    whfl5p12    whfl8o18    whfl14l24    whfl51i16    whfl4a15    whfl15o03    whfl42i09    whfl16m14    whfl48n18    whfl38n07    whfl38n08    whfl24a13    whfl10b13    whfl39p01    whfl14d07    whfl26e05    whfl55p12    whfl9m17    whfl15k11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0321900 [Oryza sativa (japonica cultivar-group)] >gi|50252685|dbj|BAD28853.1| putative ribosomal protein L10a [Oryza sativa Japonica Group] >gi|113536221|dbj|BAF08604.1| Os02g0321900 [Oryza sativa (japonica cultivar-group)] >gi|215692826|dbj|BAG88217.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215734901|dbj|BAG95623.1| unnamed protein product [Oryza sativa Japonica Group]
Score 925
Evalue 6.28245e-98
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2229
aatGTCATCAAGTTCCAGACAATAGAACAAAGCATCTCAGTACAAGACAATAATTGTCACTCCTCAGCGCACGAAAATTTGATAATTGAGAAAGCAACAA
AAGTTCCCAAGTTGTCAATCTCCTGGAAATCCTAGAAGACTAGAGCCTAGAACAACCGGTACACCTTCCCCATCGTGCTCTTCAGGTACAAGCATCTCAC
GTTTTGCCAGTTCTTCTTCAACAGAGAGACGAGGAAGTTGACGCTCATCTGCACGTTCTGGAAGATCTGCTTCTCCTCCATACCCAGGTGGCCAACGGCA
ACACCCATGCAAAGCACCTTTTTCAACTGGAACTTGACTGTGGCCTTGGTCTCATTAACCTTGGACTCAAGGGATTCCTGGTGAGACACCAAAGTTGGAA
ACTTTCCTGCCTTGTTAAGACCAGGTCCAAGAAGTCGGGGAATCTGCTTAATAATAGCCTCAGATGCAAGGAAAGCATGATACTTCTTTGCAAGCTTCTT
GACCAGCTTCTTGTTTTTGTTCATCTTCTTAAGGGATTCCACATCCATGCAGTCTAGGCCCATTTTCCCTGCCTCTTCAACGTGCTGGGCATCACCAAGC
ATGCAAACCCTCATCTTTGGGCGAGGGATGTGAGGAAGCTTGACAGAACCACTG*AAACGCTTGTCCTTTTGCGGGTCATAGTTCTTCAGACCAATCTGC
AGCTCAATGG*TTTCAACGAACTTGCGGTTCTTCTCACGGCAGTCATTG*ATAATGTTTGTGATTGCCT*CCCTCAGGGCGTCGCTCTGCAACTTACTCA
TGGCGCCGGCGGTGGGAGCACTGTTCCGcgacgaggcagggtgggagaagggggcggcgccctgagaaccgtgg
page-top