Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2508
Contig Information
Length 1622 bp
Tissue Shoot grown under continuous light
Clones 6 Clones [Download: CSV  ,  FASTA ]
whkp10c21    whkp10l22    whkp16n13    rwhkp10l22    rwhkp16n13    rwhkp17p05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19058 [Oryza sativa Indica Group]
Score 1871
Evalue 0
Total Hit Count 160
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2508
TTTTTTTTTTGTTTTTTTAAGTTACAAAGCACTGCTAACATTCTGGTGGAAAGTTTGGTCGCTGTGGTACATTTTACAACGTATTAGGAGTCCTGCGTGA
TCTGCCAGTTCTGTGATGTCATGTCCAGGATTTCTAATTGCACAAGTACCTTATGCAGTGTCATCCCAGGAAACAGGTTTCACTTTCAAATGTTACAAAA
ATAATAGCCTAGTCAAAAGTGAAACGAACCCTAGCACTAACAAAGTCAAAGATAAGGATGTCGACTAGGGCCGGAAATTTCATTTGCATCACAACATTGA
GGCCTCAATTACCTCCACTTGTCTCTTAATTCCTTTTTCTCAGACCAAATCCAAGTAACGAAAAGAGCAGCAACCAATGCGACAATAGTAATTAGAAGAA
GAGCATAACTGAATTCATCCGTGAGTGAATCATAGGTTCTTGATGGTGCAAGCCGAGTGTAGAAGAGATCCACACCATAAGTGAAAACAAGAGTAGTGGA
CTCCAACTTTGCCGGAATAGAAACAATTCCTCGCAGTGCTTCCACTTGAAGAGAGTGCGTCACATAGGACTGTGGAATAATAGGCAAAGAATCTGTTAAC
GGTATAATACCCTCTTCTTTCTCTTGTTGTGTAGGATTCAATGAACGGCGTGGGTCAAGAAAGCGCTTGTCAAGTGCCAAAACCTGATCACCAATCGTGC
CAATGAGAAGCTGCTTGGAAGTGATACCCTTGGCTGTTTGTGTAACTGCCATTGCCTTCACCGAATGAGTAAAAAAGTATGACTGGGATTTCACCATAAC
CTCTGGTCGGGAATAAGAAGTCATGGGTGCAGACAAATTGTGCTTCCCAAGTATGAGCTTCAATACATCTTTATTGTCCGCCCTAGATTGGTCATATATC
TCAATCACTGCAATTTCAAATCTGTGAGCTCGGAGGTTGAAATAATGATAGACAACCCAGTTCTCGCTGACAACGGCATGCACAGGGCCTTGTGCACCAT
GATGGGTCACACGGTGTAGTATGCGTCCGCTGACAGCATCAATGAGATATGCCACGAGTGAAGCTTCTTCAGGTGCCGCGGATCCAATTTCACCAGCAGC
ATTAGGAGACACCGTAGCAACAAAAATTAAGTTCTTTGATAAATACTTGTACATCACATCTTGATCTGCTATGATCTTTGCTTGAGTGTGAACAACCTCA
TTCATCTTTCGTGCTTCGGAGACAGAAATCCTTTCTGCGTCGGAAGGGAAAATGATAGACCATAACAACTTTGTGCTAAAGCAGTATGTGTCATCCGCAT
TGAAGTCACATGATTTCTGTAATGAATACCCTCTGATAGCATTTTTCTGCATATCTACAGAATAGAAATACTGATTTGACATTTCACTAATAAATGAATT
AAGGGCATCCGGAGATCTTGGATATAGGTGAGCGTTGCAGTTGGAATCAACAATAAGATGAAGACGCTGTTCAGATGAATCCTTCAGTGTCAATGGGATA
ATTTGGGCAACAGAATGGTCAAAGCTCCGAGAGTTGAGTTCCTCTCCGGAATACGAATCAAGAATACAGAGGACACCAGGAGCAACAGAGCTGGCTCCAG
ATCTTCCCACAACAAGTATGGA
page-top