Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2487
Contig Information
Length 908 bp
Tissue Shoot grown under continuous light
Clones 6 Clones [Download: CSV  ,  FASTA ]
whkp2j01    rwhkp2j01    rwhkp2j02    rwhkp5e18    rwhkp6m08    rwhkp15g13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|396134|emb|CAA80666.1| protein synthesis elongation factor-1 alpha [Hordeum vulgare subsp. vulgare]
Score 1110
Evalue 2.40509e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2487
AACGACTCCAACATGCCAACTATATATAGTAGCAACATTAACTGACGAAGTTTCACCAACACAACCGAACGATACAATGACAGAGCAATAAGCAGTTCCA
ACACTGCTCGACACAAATAACCGAAGCTTAACAAGTTTCCAAAACAACTAGAACAACTATCACCACCACCAAATACCGCCACCGCCACCATAGATGCAGT
AAAGAACCTGACACCATCTCATTTCTTCTTGGCCGCAGCCTTGGTCACCTTGGCACCGGTCGGATCCTTCTTCTCCACAGCCTTGATAACACCCACGGCA
ACCGTCTGCCTCATGTCACGCACAGCAAAGCGGCCCAGGGGAGGGTACTGGGCAAAGGTCTCCACCACCATGGGCTTGGTGGGGATCATCTTGACGAACC
CAGCATCACCGTTCTTGAGGAACTTGGGCGCCGCCTCAATCTCCTTGCCAGACCGCCGGTCGATCTTGGTCTGGATCTCAGCAAACTTGACAGCAATGTG
GGACGTATGGCAGTCCAGCACCGGGGCATAGCCGTTGCTGATCTGGCCGGGGTGGTTCATGATGATGACCTGGGCGGTGAAGTTGGCAGCCTCCTTGGCA
GGGTCGTCCTTGGAGTTGGAAGCGACGTACCCACGCTTGAGATCCTTGACAGCCACGTTCTTGACGTTGAAGCCGACGTTGTCACCAGGAAGCGCCTCCA
GGAGAGACTCATGGTGCATCTCAACGGACTTCACCTCAGTGGTCAGGCCAGTAGGACCAAAGGTGACAACCATGCCTGGCTTGATGACTCCAGTCTCAAC
ACGGCCCACTGGCACAGTTCCAATGCCGCCAATCTTGTACACGTCCTGAAGGGGAAGACGGAGGGGCTTGTCTGAGGGCCTCTTGGGCTCATTGATCTGG
TCCAGGGC
page-top