Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2461
Contig Information
Length 1493 bp
Tissue Shoot grown under continuous light
Clones 6 Clones [Download: CSV  ,  FASTA ]
whkp10c22    whkp16f18    whkp20j01    rwhkp10c22    rwhkp16f18    rwhkp20j01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24967 [Oryza sativa Indica Group]
Score 1453
Evalue 8.43584e-159
Total Hit Count 50
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2461
CATATAGGGAGGAAGCTTTATTCTGTAACAACCAAGGTTTCAGACACAGCATAACAAATTGCTTGAAGGACAACCAGAATATAATTGTTTCTGTGTAATA
CGAGTATATATTAGCATCAGATTACAGATGCATAGACTGACGACACACCATGACATGGTACTATAGCACCTTATTCCACTTGTCTCATCCCAGAAAACAT
CACAAACAGCTCTGCTTTCTAGGAACAGGCAAGGCAATTACATACACGATAAATAGAAATCGGTACCTGGCCGCTAAGTTCCGCGGTTAGAAGCACATGC
TAGGGGTAGGTGCAGGAGCGCCTGCGTTAGCAGAGCCAGGCATCTTCAGCGCAAGAGGATCCCACGCCTTGCCCTCGGCGTCGCTGCAGCTGCCGCTCTT
ATCTGGATACATGACAGTGACTGCGGTGGTGGGGCCGGCAGTGCCCTTTGCAGCCAGAGTCTTCAGGCGGATGCGCTCAGCCCTCGACCCGATGGTCTGC
CCGAGGATGGAGGCTGCTATGGTGAACACCATCGCGGTCCTGGGCATGTTGACAGACTTCCTCAGCATCGCGATGAACGGAACGGCGGCGTGCACGGCAG
CGAACCACTGGGGAGAGAATTTCTTGGTGTGCTCGCGCCACACCCCTAGAGGGACGTTCGCTGCCATCCCGAGCATTGCGATGGCTACCATCTTTGCAGG
CAGGGGCTGCGGACGGAGGGACTTCACGAGGGTTGTGCGTGCAAGGGCCGCTCGTGCAGCAACAATTGCAGGCGGGCACTTCAGCTTCATACCAGCTGGT
GGCTGTAGTGCCTTGGCAACAAGGGGCAGAACACCACTCATTGCCCGGTAAGACCGAGCTAGTGGGCACTGTCCATTTTCTAGCCATTCATCACTCATTG
CCTCGTGGGACGGTGGGTTGCCTCCTTTTTGTTTCATGGAATTCTGATCTGGCTTGTTGGGCTTCTTCTGTGACTGGTCGAGATTGTTGGGCTTCTTGTT
CTGCTTTTTGCCCTTGCCATTAAAGAAGTTAAACCCGAATGGTCCAAATGCTGATAGGCTTATGGTAGCGGCTCTAGCAGCCAATGGATTAAAGGGCAGA
GCAGGTTCAGGCTTGACATCAGTGCTCTCACTGCGGTTCTCATCAGGCACATATGATCTTCCTGAAAGGGGAACTATCCCATCCTGTCCATGAAAAAGCT
TGAATGCCGACTCAAAGCCTGGTCCATCCTCAAAGATCGGACCTTTGCCTCCTCGGGCAGCTACAGGCAAAGCAGAAGAAAATGAAAAGGTTGTAGCTCC
ATTGATGTTCCTCAGGAATGGGCATCTCTCAACACCGGGATGACCAGAAAAGTTCTCCGATGATGCTGAATCACAGAAAAGGCTGCTGAAGAGCATTTCC
ATCCTCGCCGAGTCGCTGAAGAGCTGCTCGCCTGCGTGCTTGGCTCCGTCCGTGCGGTGGGGGGAGAGAGGAGTCGTGTGGTGGGCACAGCGC
page-top