Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2379
Contig Information
Length 442 bp
Tissue Shoot grown under continuous light
Clones 5 Clones [Download: CSV  ,  FASTA ]
whkp10a14    whkp11j19    whkp11n09    rwhkp10a14    rwhkp11j19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative proteinase inhibitor [Hordeum vulgare subsp. vulgare]
Score 245
Evalue 1.14734e-19
Total Hit Count 215
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2379
CCGGAATCAATTAACAAGCTCGAGGTCCATCTAGCTGCAGGTGAGTCGGATCACAAACACATATCCCGTCTGCGTGCCGGATCGACGACAATGAGCTCCA
CGGAAGCCACCGCCGCCGGAGGCCTCTTCGTTGAGGAGACGAAGGCGTGGCCGGAGGTGGTGGGGAAGTCCATCAAGGAGGCCAGGGAGATCATTCTGAA
GGACAAGCCTGAAGCCGACATCGTCGTCCTCCCAGCAGGGGCACCGGTCACCCTGGACTTGAGGCCCAACCGTGTGCGCATCTTTGTCGACACCGTCGCG
GAAACACCCTTCACTGGCTAGGCAGCTTTGCAGGCCCGAAGGAATGTATGCTTGCACCATGCATGCTCATGAATACGTTTTTATCAATGGATAAATAAAT
GCAGGCATGTAAGCATTAGCATGTCATGGATCAAAAAAAAAA
page-top