Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2213
Contig Information
Length 1036 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 43 Clones [Download: CSV  ,  FASTA ]
rwhfl11f09    rwhfl36n20    rwhfl8p18    rwhfl25h20    rwhfl36m17    rwhfl36k02    rwhfl18a03    rwhfl33b17    rwhfl34e18    rwhfl37k10    rwhfl33b18    rwhfl50d24    rwhfl26f05    rwhfl37m17    rwhfl31l16    rwhfl10d05    rwhfl43l04    rwhfl36k13    rwhfl38k10    rwhfl18a15    rwhfl24o12    rwhfl34f05    rwhfl37n20    whfl26f05    whfl33b18    whfl33b17    whfl36m17    whfl37m17    whfl25h20    whfl37k10    whfl18a03    whfl10d05    whfl31l16    whfl50d24    whfl38k10    whfl11f09    whfl8p18    whfl43l04    whfl36n20    whfl34e18    whfl34f05    whfl18a15    whfl37n20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0393300 [Oryza sativa (japonica cultivar-group)] >gi|75144180|sp|Q7XRU4|MUB4_ORYSJ RecName: Full=Membrane-anchored ubiquitin-fold protein 4; Short=Membrane-anchored ub-fold protein 4; AltName: Full=OsMUB4; Flags: Precursor >gi|38347220|emb|CAE02286.2| OSJNBa0055C08.14 [Oryza sativa (japonica cultivar-group)] >gi|113564219|dbj|BAF14562.1| Os04g0393300 [Oryza sativa (japonica cultivar-group)] >gi|116309376|emb|CAH66456.1| OSIGBa0145N07.12 [Oryza sativa (indica cultivar-group)] >gi|215679359|dbj|BAG96499.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215708699|dbj|BAG93968.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765491|dbj|BAG87188.1| unnamed protein product [Oryza sativa Japonica Group]
Score 558
Evalue 2.97574e-55
Total Hit Count 61
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2213
ctTTCCGGAGTCTCAAGTGAGAACAAACAATCAGGTTGCGTGACACACCCAACAACCTTGACCCTTTTTAACCCAACTTGGCACGGCG*ACGAACAGCAG
GTCCTTCACCTCCACAACAggcAACAGCACCAGCAATGTGTGTGTATCTTGTACATCATATAGAAACATCCTTTGTTGGGTAAAACAAGACAAAGCGACG
CTATTGCCCTAGCGACAGAGGGACCGGACCGACTCTTGTGTAGTATCTAGCTTACAGTTACAATATCACCTCACAACAATACACGACACGTCTTGGGTGC
TGGATGTTCCACTTCTGTCCAGTCGTCTCTCTTGGTGGGCACACAAATTATTGTCGACGGAGTACACTTGACATTCATAGTATGGTACAAGAGCAGCGAG
TGGTCTTAGGCAACTTGTTCGTCTTCTTGTCTGGTTTTGACTTTGCGGATGATGGCTGGACAACAACATGC*ATTGTTATAACAGTGCTGGGAAGATCAC
CAAAAGGTGCTCTGCACTGTGCAATATTCTTGTCATTTTCTAGAATTTTGCCTCCACTTATCAGTTTCACATCATTAGCACTCTTTGGGACAATTGTTTT
ATCTTTGGGCCAATCGGCAACGACGCGGTCCTTGAGTGCGGCGACGGTGGTAGCAGCGGCGTTGCAGCGGATGGGG*CCGATGTCAGAGCCGTCGAAGAG
CCGGAACTTCACCTCT*ACCTCC*TCCTCCTCCGCTCCCGCCCCTGCATCCGCTCTCTCTT*CCTCTCTCGTTCCC*T*CCACCTTGGTCTCCTCCCCCT
TCCGCCATTTCTTGGCTTCCCGCCAAGACCTCGAATACTCCCGGGACCCCGCGGGGAATCTGAGCTGGGCTCGGCTGCTCCAATCAAGAACTTGCGAGCT
CGGTGGGGGTAGAGACGGGAGGGATTCGGAGCTTGGTTTAGGGTTTGGTGGGAGGCAACGAGGGTAGGAGAGGAGGAGCAGGAGAGAAGAGGAGACGCTT
TGCAACTGCAAAGGAAAGGTAGGAGAAAATTCTctt
page-top