Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2373
Contig Information
Length 1224 bp
Tissue Shoot grown under continuous light
Clones 5 Clones [Download: CSV  ,  FASTA ]
whkp10a15    whkp17k06    whkp19l07    rwhkp10a15    rwhkp19l07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glutathione S-transferase 1; AltName: Full=GST class-phi >gi|21788|emb|CAA39487.1| glutathione transferase [Triticum aestivum]
Score 1093
Evalue 3.5662e-117
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2373
AGTCTTGCTCCAGTATCTGCCCTCTCCTGCCTGTAGAGCATCCCTCATCACGTGAAGTTCACGGACAAACATGTCTCCGGTGAAGGTGTTCGGGCACCCG
ATGTTGACAAACGTCGCACGGGTGCTGCTCTTCCTGGAGGAGGTCGGCGCCGAGTACGAGCTCGTGCCCGTCGACTTCGTCGCCGGCGAGCACAAGAGGC
CCCAACACGTCCAGCTAAACCCGTTTGCGAAGATGCCTGGGTTCCAAGATGGCGATCTCGTCCTGTTCGAGTCGCGCGCCATCGCGAAGTACATCCTCCA
CAAGTACGGGGGGACAGCCGGCCTGGACCTCCTCGGAGAAAACAGCGGAATCGAAGAATTAGCAATGGTGGACGTGTGGACGGAGGTGGAGGCCCAGCAG
TACTACCCGGCCATCTCGCCCGTGGTGTTCGAGTGCATCATCATTCCCTTCATCATCCCTGGCGGTGGCGCGGCGCCGAACCAGACCGTCGTGGACGAGA
GCCTGGAGCGGCTGAGGGGTGTGCTGGGGATCTACGAGGCCCGGCTGGAGAAGAGCAGGTACTTGGCCGGGGACTCCATCAGCTTCGCCGATCTGAACCA
CATTCCATTCACCTTCTACTTCATGACCACCCCGTACGCCAAGGTGTTTGATGAGTACCCCAAGGTGAAGGCCTGGTGGGAGATGCTCATGGCGAGACCG
GCGGTGCAGAGGGTCTGCAAGCATATGCCTACCGAGTTTAAGCTACGTGCGCAGTACTAGATGTTTATGTACTCCGCGCGGGTGTGTGCCGTGCCGGTGC
CGGTTCAAGAGAAGAGACCTCCCGTGGCTGTGGGTGATCATCTGCCCGTCTAGTTCGAGTATATGCTTTCAGTTTCAGCAGCGCAAGGAATCCGCTTGCG
CTTCTGTTCGTGCGCTGGATTCCGCTTTAATTTGTGCACTAGTAGTAAATAAACAACGGACTGGTCAATGCTGCTAATCCGTATGTCCTATATAGTACTG
TACACCACTAGAGATCAGAATGGATCCAAAGCAAATACCAAGAATACTAGGCCCGTAAGGGTTCCATTTTTCTGGTTTTTTTGATTTTTTTTTTACTATC
CTTGTTTGAGTGACAGGCATACAGGCTGGTTTTCTAGAGTGGACTTGTTTTATATTTTGCTTGCTAGGGTTGTTCTAGCACGTCCGAATCTATGCATGGT
TGCCACGTCCGGTGCCCTTGTGTC
page-top