Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2369
Contig Information
Length 762 bp
Tissue Shoot grown under continuous light
Clones 5 Clones [Download: CSV  ,  FASTA ]
whkp10c12    whkp3d20    rwhkp10c12    rwhkp12c13    rwhkp3d20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Chlorophyll a-b binding protein of LHCII type III, chloroplastic; Short=CAB; Flags: Precursor >gi|19023|emb|CAA44881.1| type III LHCII CAB precursor protein [Hordeum vulgare]
Score 1191
Evalue 7.08324e-129
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2369
TCAATTTCGAGATCACATCGACCATTCGTTGCTATTTGCACACACACACACACATGGGAGTAGTTTACACTTTACAATGGCAACGTCGGCCAGCCTAAGA
TCCAGGCGCAAACTTGGTGGCGAAAACCCATGCATTGTTGGCGACAGGGTCGTCGAGGTGGTCGAACAGGTTCTCCAATGGGCCCTTGCCGGTGACGATA
GCTTGGACGAAGAACCCAAACATGGAGAACATGGCGAGACGGCCATTCTTGATCTCCTTCACCTTGAGCTCAGCGAAGGTGACAGGGTCGTCGGCAAGGC
CGAGCGGGTCGAAGTACTGGCCGCCGGGGTAGAGGTCGTTGCCCTCGCCGACACCGTCGAGACCATTGATGCGGAACCCTTCGACCAGGCCCATGAGAAG
GACCTGGAAGCCCAGCACGGCAAGGATGCTCTGCGCGTGGACGAGGTTGGGGTTCCCAAGGTAGTCGAGGCCACCCTCGGAGAAGATCTGCGAGCCGGCC
TTGAACCAGACGGGCTCCTTGAACTCGACGCCCACCCACTTCTGGAGCACCTCGGGGAAGACGCACCCAAGAGCGCCGAGCATCGCCCACCGCCCGTGGA
TCACCTCCAGCGCCCTGTTCCTAGCGAACGCCTCCGGGTCGGCGGAAAGCCCGGCGGTGTCCCAGCCGTAGTCGCCCGGGAACTCGCCGTTCAGGTAGGA
CGGCGTCTGCGCGGAGAAGGGCCCCAGGTACTTGACGCGGTCCGGGCCGTACCACAAGTCGT
page-top