Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2317
Contig Information
Length 653 bp
Tissue Shoot grown under continuous light
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkp10a01    whkp11l15    rwhkp10a01    rwhkp11l15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit FD-like 15 protein [Triticum aestivum]
Score 500
Evalue 6.87176e-49
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2317
GCTCCCTCGCCTCCATCTCCAGCACCGCCGCTCCGCCTGCCCGCCTGCCCTCCCTCTCCCTCAGCATCGGCACCGGCGGGGAGGTCCAGCAGCCGGGCGT
CAGCAGCGACGACGGCCACAAGAGCGTCCGGGCGATGAAGAACAGGGAGTCGGCGCTGCGGTCCAGGGCCAGGAAGAGGGCCTACACGCAGGAGCTCGAG
AAGGAGGTCCGCCGCCTCGTCGAGGACAACCTCAAGCTCAAGAGACAGTGCAAACAGCTTCAGTCGGAGATTGCCGCACTCACCGCCCAGCAGGCAAGCA
ACAAGCAGAGCAGCCCGCACAGGAGAACTTCGTCCACTCAGTTCTAGCAGCGCTACACCAACACCAGGATGCGCGAGGGCTTCATTTTCCTCCTGCTAGC
AATTGATTAGTATTAGTGGGCACGAGTAGTTGGTTCTTGGCCTCAATCAACCCAGCTGCCCGATCGATATGCCAGCGCGTGGTCCGTTCATCTCATGTGC
ATTTATCTGCATGTATTGCTGTGTGCACCAGTCAGCCTGGATGCCCGGACCAGCCGCACAGGCAACCTGCCTGCAATCAATTGTGTTGCAGAATACCTTT
ATTAATAATGCTGAATCGCAATCCAATTGTGCTTGTTAGCTTCAAAAAAAAAA
page-top