Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2314
Contig Information
Length 1408 bp
Tissue Shoot grown under continuous light
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkp10d23    whkp1f10    rwhkp10d23    rwhkp1f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0324300 [Oryza sativa (japonica cultivar-group)] >gi|46390502|dbj|BAD15962.1| nuclear protein-like [Oryza sativa Japonica Group] >gi|113536227|dbj|BAF08610.1| Os02g0324300 [Oryza sativa (japonica cultivar-group)] >gi|125539226|gb|EAY85621.1| hypothetical protein OsI_06994 [Oryza sativa Indica Group] >gi|125581886|gb|EAZ22817.1| hypothetical protein OsJ_006300 [Oryza sativa (japonica cultivar-group)]
Score 963
Evalue 2.71562e-137
Total Hit Count 287
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2314
CTTTTCCTCTGCCCGCCGCTCACCCGGAACCTCCCCGTCGCCGCCGCCGCTCGCCCGAGACCTCCCCGTCGCCGCCGATCTACCGGAGCCTCCGCTCGTC
TCCCCGCTGATATCCTCCTCCTCCTCCTCCTCGCCGGAGACAACATGTCGACGCTTGCCGCGGCGAGGGCCGACAACTTCTACTACCCGCCCGAATGGAG
CCCGAAGAAGGGTGGGCTGAACAAGTTCCACGGCCAACATGCCCTCAGGGAGCGGGCCAGGAAGCTGGATCAGGGCATCCTGATTATAAGATTCGAGATG
CCTTTCAATGTCTGGTGTGGTGGATGCAGTTCCATGATAGGGAAGGGAGTAAGGTTTAATGCTGAAAAGAAACAAGTTGGAAATTACTACTCTACCAAGA
TATGGAGCTTCAGTATGAAATCACCATGTTGCCAGCATGAGATAGTCATACATACAGACCCGAAGAATACTGAGTATGTTATAATCAGTGGGGCTCAGCG
GAAGACTGAAGATTTCGATGTTGAAGATGCAGAGACGCTCCTGCTCCCTGCTGATGAAGAAAGAGACAAGCTTGCGGATCCCATGTATAAGCTTGAACAC
CAGGGAGAGGATATTCGGAAGAAGAAAGAAGAGGAGCCTGTTTTAGTTCGGCTTCAACGCCTCTCTGATAGCCGTCATTCTGATGATTATTCCCTGAACA
GAACCCTCCGCGACCGCCTTAGGGTCATCTAGTGAATTCCTTTGTATAATTTTTCATCAGTAAGTTGTCTAACAGTCAGGATTCTTATCCACTTGTTGTC
CTATTATTTATGTAGAGCCAAAAGAAGAGAGTTGCTGAAGAGAAGAAATCAGCGAGGAGGATGGGGCTCGGAGTACGCCTTCTGCCACCCTCCGCAGAGG
ATGCTGCCGCTGCAGCTCGTGTGAGGTTCGCCTCGAATTTCGAGAAGAACAGGAAGGACAAGAGAGCAGCGATCAAGGCCGCCTCCATCTTCCCGGAGCC
ATCAGGCTCAGCTTCGAAAGACAAGCTAGACCTTGCGCTGAAGAGGCGGAATATAAAAGCTAGTGCAGCGTCGGCGCTGATGGCGGGCAGGGCAAAGCCG
TCGTCGTGGTCGCGGCAGAGCACCGGTTCTGGAAGTGCAAGGACTGCTGTGCCGATATTGGCAAGGCGCAAGTAGAGCCACACCCCGAGTTGTGCTTGCG
CAACCAAGCAAGAATTTTGTGATCTTGTCCGGTCTGTTGCTCAGTACGCCCCATGTATACGTGTATCTTGTGTAGTACCTTCATTGATCTAGCAGTGTAC
TGTAACCTTGGTGTTATGTCCTGCTGTCGTGGCTGGGGCTGTGAGCCTGTGACATATCATGAGAAACTGATTTGCCTTGTAACTGATGATTCTGGACTAA
AAAAAAAA
page-top