Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2312
Contig Information
Length 750 bp
Tissue Shoot grown under continuous light
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkp10e20    whkp20i01    rwhkp10e20    rwhkp20i01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.4; AltName: Full=H2B153 >gi|531054|dbj|BAA07159.1| protein H2B153 [Triticum aestivum]
Score 484
Evalue 6.56096e-47
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2312
CTCCAGCCCAGTCAAACTTCTCTCGACCTCGAAGCATCAGCCGCCGCACCATGGCCCCCAAGGCAGCCGAGAAGAAGCCGGTGGAGAAGACCCCCGCGGG
CAAGAAGCCCAAGGCGGAGAAGAAGGTGCCGGCGTCCAAGGAGGGCGGCGACAAGAAGGGGAAGAAGAAGGCCAAGAAGAGCGTGGAGACCTACAAGATC
TACATCTTCAAGGTGCTCAAGCAGGTGCACCCGGACATCGGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGC
TCGCCGGCGAGTCCGCCAAGCTCGCGCGGTACAACAAGAAGCCCACCATCACGTCCCGGGAGATTCAGACCTCCGTCCGCCTCGTCCTCCCCGGCGAGCT
CGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCCGTCACCAAGTTCACCTCGGCCTAGTTTCCTGGTCTGATTCTTGTGTTCCCTTCCTGGTCCTTGTCT
GATGAATTCTGTAGGTAGCTGTGTTCTGACAGTGTCATGCGACATTGTCATCTTGTAACAGAGTTTCTGCTTGTGGGTTTGTGGCTGTTATTCGGTCTGG
TTAAATAGTCAACTTCACCTCATCCTAGTATTCTCATCTAATGTGGTGAACTGTAGTTAGATGTGTTCTGAAAGTGTCATCATGTAACTTTGTGCTGATG
GTGGCTGTTTTCAGTCTAAATAAATAGTCATGTTGCTGCTAAAAAAAAAA
page-top