Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2291
Contig Information
Length 783 bp
Tissue Shoot grown under continuous light
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkp10d11    whkp10d12    rwhkp10d11    rwhkp10d12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Pc22g09180 [Penicillium chrysogenum Wisconsin 54-1255]
Score 78
Evalue 8.59769
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2291
CATCCCGGTCGTGAAGTGTGGATCTTCCTTTCAGTCCCAGGTGATTCTTTTGAGCTAAGTCGGGAGGGAGGCCCCTACCTTTTTATGTCATTATAAAACA
AGATCGTTCGTCTCTAAGGAGAGCATGAATACTTGATTTGAGTACAAGAAGAAATAAACAGCTGCAGGGGGGACCGAAGAGGAGAAAGAAGGACAAAGAA
AAAGGAAGGGAGAGGGAAAACAAGAAGGCTGAACAAGAACTAGCGTAATCAGTCATTGATTCACCTACGTGCTGAGCATGTGTCCTCAATTTTTAGTCCA
TGAGCCCACGATTTAACCGCCTCCAAGCATTGATTCACAACTCAACTCAGGTGGGATGGCCATGTTGTCAAAGACTTGCCTATTTCAAGCCAGCCATATA
GTCCAACGGCAAATGGTAACCTTTCCATGCTGTTATTTTTTGCTTACAAAATGGATTGCTCCAGGTGTCAAAGACGTCAGACGTTTCTTAACTGTTTACC
CCCAAGATATTTGGATTCTCTTTAGTTTGGTTGAACTGCAAAGCAAATTGCGCCGTTGTTTCCTAATCTGCACCGCTGAAGTGACATGCATTGTCGGCCA
TAATTATTTGTTTTTTCAGCAGAACTGAACAAACATCAGGCCTTTTTCTGACCAACAACCAGCCAAAGAATTCTCCTTTTCTTGGGTCTCTAGGTGATTT
TTCCTTTGTGGATTTGTGTTCCCAATGGAGTCAGTTTTAATACATCACATTTATATTCCAGAGGAAATTGGTTAAAAAAAAAA
page-top