Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2287
Contig Information
Length 780 bp
Tissue Shoot grown under continuous light
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkp18l18    rwhkp3a13    rwhkp9c24    rwhkp18l18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cobalamin-independent methionine synthase [Triticum monococcum]
Score 671
Evalue 1.48629e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2287
TTTTTTTTTTAACGTAACAAACTCATGACTTAGATGATGAACAATTCGCCACTCAGTTTACAATACACACCGACAACCGCCTCAAAAACCACCAAATCAA
AGGGATGAGCACATGGCGCCGCGCCGCGCCGAGAAACAAACTAGCCTAACCAACAGGTGGATACAGAGACCCAGATTATTCAAAGTAAACACGGCTATGG
TGGCGACATCCTCCTTGCAATTAAAATGGGGGAGCTGCTATACGGCTTACTGCGCCTTGGCGAGCTCGGCGCGGATCTGCTTGGCGGCCTCGACCATGTT
GGTGAGGGCGGGCTTGACCTCGGCGTACTTGCGGGTCTTGAGACCGCAGTCGGGGTTCACCCACAGGATGTTGGTATCGAGCACCGCGAGCATCTTGTTG
ACACGGTCGGCGATCTCCTCCTTGGACGGGATCCTGGGGGAGTGGATGTCGTACACGCCCGGGCCAATGCCGGCGCCGTACACCACGCCCTCGCGGAAGA
CGGAGAGAAGCTTCTCGTCGGACCGCGAGTTCTCGATGGTGATCACATCGGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGAAGTTGGAGTAGCA
CATGTGGGTGTGGATCTGGGTGGTGTCCTGGACACCNCANNTGGNGATCCTNAANGANTGCNCNGNCCNNTNNANNNANAAANNNNGNTCCNANTTNNNN
ANNGNNNNANNCTCTNTNNNNNNNNCNTNNTNNANTTNNATNNNNTNAATANNNNNNNNNTNNNNGNNNTCNANCTNCTT
page-top