Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2201
Contig Information
Length 626 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 40 Clones [Download: CSV  ,  FASTA ]
whfl14i20    whfl13c12    whfl53e12    whfl13c11    whfl52i17    whfl40i11    whfl36h03    whfl13c23    whfl3a02    whfl50d08    whfl17c19    whfl25o07    whfl55e04    whfl27a10    whfl29j23    whfl54a07    whfl55b02    whfl39g09    whfl48i13    whfl17m18    whfl18b04    whfl10f01    whfl2g02    whfl34e05    whfl54a08    whfl4m14    whfl50e01    whfl41b16    whfl18b03    whfl40f02    whfl27b03    whfl13g22    whfl36i19    whfl5f10    whfl13h10    whfl13h09    whfl16i19    whfl15c18    whfl36d11    whfl54l08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 202
Evalue 3.6901e-26
Total Hit Count 178
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2201
cgagaaccggaACAGCGATGACTCGAGAACCGTCTCTCCACACCACAAGCCGCCGCCACCGCCCGCTGGGAGGGGAATAGAAATCGTGTATCGTAGGGTT
GCGCAAATCGCCGCCTCCAGCAACCAATCCCCAACCCTCGAGCTATCTAACTATCCCGATCCCGATCCCGATCTCCTACCATGGTGTCCGATGCCAGCAA
GAAGAAAGCCGCGCAGAAGAAGGCCGCCGCCGCCGCCAAGAGGGGAGCCAAGTCCAGCGCCGCTGCCTCGTCCTCGTCGGCGTCGTCAGCGGCCGATAAG
GCCGCCAATGGCGTAGCGGCCCTTAACTTATCCGATCGGACATTGTACCGGGGTCCTGGCTTCGccaTCCGCTCTCCCGTGATATCCA*CATTGAGTCCC
TTTCATTAACATTTCATGGACATGACCTTATTGTGGATTCAGAATTGGAGCTTAACTACGG*GAGGCGGTATGGTTTGCTCGGCTTAAATGGTTGTGGGA
AATCTACCCTTCTCACCGCAATAGGCTGCAGGggaACTCCCCATTCCTGAACACATGG*ACATACATCATCTTACTCGTGAGATTGAGGCTTCTGACATG
TCTGCGCTGCAAGCTgttaTCTGTtg
page-top