Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2245
Contig Information
Length 946 bp
Tissue Shoot grown under continuous light
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkp10c07    whkp10m01    whkp4m13    whkp15m03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|19569141|gb|AAL92029.1|AF486280_1 cytosolic 6-phosphogluconate dehydrogenase [Oryza sativa] >gi|7363280|dbj|BAA93024.1| putative phosphogluconate dehydrogenase [Oryza sativa Japonica Group] >gi|113594626|dbj|BAF18500.1| Os06g0111500 [Oryza sativa (japonica cultivar-group)] >gi|125595798|gb|EAZ35578.1| hypothetical protein OsJ_019061 [Oryza sativa (japonica cultivar-group)] >gi|215686886|dbj|BAG89736.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1160
Evalue 4.085e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2245
TTGACATTTATAGCCTCACATTCAGTTATCCATTTGCTACTGTCTGGAACCTCTGTTCGCATGCAAACAGTTTGTCAGAGTGAAGCTTGTTCTTGCGTCC
AGTGCATATGCATCATCGTTTGGCCTCTCTAGGCAGGCTTTTATCCTTTCTAGTAAGACATGCATAAATAAATGATCTAACTAACTTTGTGTTTGGTGCA
TATCTTTTTCAGGTACAAGATGGCTCTCACCAGAATTGGTCTTGCTGGCCTCGCCGTCATGGGGCAGAACCTTGCCCTCAACATTGCAGAGAAAGGCTTC
CCCATCTCTGTCTACAACAGGACCACCTCCAAGGTCGATGAGACTGTCCAGCGCGCCAAGCTAGAAGGAAACCTTCCCCTGTACGGTTTCCATGACCCTG
CATCCTTCGTCAACTCCATTCAGAAGCCACGCGTCGTCATCATGCTTGTCAAGGCTGGCGCACCAGTTGACCAGACCATCGCCACGCTCGCAGCACACCT
GGAGCAGGGCGACTGCATCGTTGATGGAGGAAACGAGTGGTATGAGAACACAGAAAGGAGGGAGAAGGCGATGGAGGAGCGTGGACTCCTCTACCTCGGG
ATGGGTGTTTCCGGAGGAGAGGAGGGTGCCCGCCATGGCCCCTCCATGATGCCTGGAGGCTCGCTGGAGGCGTACCAGTACATTGAAGACATTCTTCTCA
AGGTGTCTGCTCAGGTCCCTGACAGCGGCCCGTGTGTCACATACATTGGGAAGGGTGGATCCGGAAACTTTGTCAAGATGGTTCACAATGGTATTGAGTA
CGGTGACATGCANCTGATCGCTGAGGCGTATGACGTTCTCAAGTCGGTTGGCAAGCTCACAAACGGTGAGCTGCANCANGTTTTCACCGAGTGGAACAAN
GGTGANCTCCTCANTTTCTTGGTCNANATCACTGCTGATATATTCA
page-top