Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2217
Contig Information
Length 1059 bp
Tissue Shoot grown under continuous light
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkp10c24    whkp7k16    rwhkp10c24    rwhkp7k16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37850 [Oryza sativa Indica Group]
Score 1067
Evalue 8.48676e-129
Total Hit Count 49
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2217
GTCTCACCTCCCACGTCGCACCAACCCCCACCCCACCCCCGTCGAAGCGCGGTTTCTTGCGTGGGCGGCCGCCCATCAGGGTGACATCGGAGTTCGACAG
CGAGCGCCAGCTCTTTTCCCACCGCATCTCCTGCCGCGTCCTCAACGGCCTTGCCAAGCTCCGTCTCCGAGTTCACCACGGGGCCGCGGGAGGGGCCCCG
ACTCCCCGAGGTGGCGCTCATGGGGCGGAACTTCTCCGCCGTCGTCGACACCGCCTCCCGCGGCGCCGTGCTGCGAGGAACGGCCGACCTTGCCGGATCG
CTCCACCTTAGTGCGGCGCACAACACGAAGGAGGGACAAGGAGAAGTGGCAGTAACTACTAATTTGGGAGATTCACCATGCAAAATTGAGTTATCATCGC
TGGTTCCTCCTGATGGATTGCCAAGAGCAACCTTCTTGTTTCCTAACGGGGAAGTTTCAGTTAAGGAGAAGAAGTTGGATGAGGGTGAGAAAATTTTGTC
AGTAAATGGTATAGTGAAGTCTCATATTCTGAATGGAGTTTGCACTGCATTGTACAATGATAATATGATGAATATCAAGTATCGCTATAAGGATGATGAG
CTATCATTTATTCCCAGCCTCACTTTACCATCAAATTCACTATCATTTGCATTTAAACGCCAGTTAACTCCTTCAGACAAGTTCAGTTACCGGTACCATT
TTGACACGAACTACTGGAGTGCTGTCTATAAACAAAAGGCCAGTAAGCATGTCAAATGGAAAGCAGGTTATGGGTCGGACGAAAGGCTTGGCTGGGCATC
TGTTTGGGTTGGCGACGCAGGCGGCAAGACAAAGGAGGCCCCCCTGAAGACAAAAGTCCAACTCGTGATAAAAGTCCCTCAGAACAATATACATAATTCA
ACTGTGGTGTTCCGGGTGAAGAAAAGATGGGATTTTTAGTTTGGATATTTATTGCGCAGAGAAGGTGAGCAACAATAAGAAATTTGAATGCATGTGCATC
CGCTGTGTGGAAATTGAAAGGACAATAGTATGTTACTCCCTGTCGCCCAGTTGAAGTTA
page-top