Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2195
Contig Information
Length 1133 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 39 Clones [Download: CSV  ,  FASTA ]
whfl37b19    whfl44e08    whfl54l04    whfl53l04    whfl28g08    whfl18g23    whfl29g08    whfl53l16    whfl11d14    whfl35i18    whfl34f17    whfl50a03    whfl8e23    whfl8e24    whfl8f11    whfl28e17    whfl5n11    whfl53a18    whfl44l20    whfl9f20    whfl10e07    rwhfl8e23    rwhfl24a07    rwhfl8e24    rwhfl28e17    rwhfl5n11    rwhfl37b19    rwhfl11d14    rwhfl53a18    rwhfl44l20    rwhfl50a03    rwhfl54l04    rwhfl53l04    rwhfl28g08    rwhfl44e08    rwhfl44n07    rwhfl54f18    rwhfl54a09    rwhfl53l16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14032 [Oryza sativa Indica Group]
Score 700
Evalue 7.94437e-93
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2195
tcATCGCTGTCTGGAACAGCGATGACTCGAGAACCGGAATGCAGTAAACACCAGAAGCATCAAAACTATGATGCACTCTCTCCCCCTTCTCTCTCGTGAC
CTCCTGTTTCCGCCCACCTTCTCCGGCTCCGGCGCCGGCGAACCCACCGCGGATCGAGCGATTCCTCCGATCAGGAGAGGCCAGCCGGGAGGAAGAGCAC
CTACGCGGGAGGAGAGGAGATGGGGCTCACGTTCACCAAGCTGTTCAGCCGCCTGTTCGCGAAGAAGGAGATGCGGATCCTGATGGTGGGTCTCGACGCC
GCGGGAAAGACCACCATCCTCT*A*CAAGCTCAAGCTCGGCGAGATCGTCACCACCATCCCCCACCATCGGGTTCAATGTTGAAACTGTGGAGTACAAGA
ACATCAGCTTCACTGTCTGGGATGTCGGGGGTCAGGACAAGATCAGGCCACTGTGGAGGCATTACTTCCAGAACACACAGGGTCTCATCTTTGTTGTGGA
CAGCAACGATAGGG*ACCGTGTTGTTGAAGCAAGGGATGAGCTCCACAGGATGCTGAATGAGGATGAGTTACGTGATGCTGTGCTGCTTGTGTTTGCTAA
CAAGCAAGATCTTCCAAATGCCATGAATGCTGCTGAGATCACTGATAAGCTTGGCCTGCACTCCCTTCGCCAGCGACACTGGTACATCCAGAGCACTTGT
GCTACAACAGGGGAGGGACTGTATGAAGGCCTGGACTGGCTGTCCAGCAACATTGCCAACAAGTCCTAAATTTTCGTCAAGATTTTGAAGGAGCTAGGAG
CGCTTTGGATGGACGATTGAATCACCGGGTACCTAGGGATTGTGTTGGGATGGGATGGTGCTATGCTATTCCCGTATGTACTGTGTATTTTCCTGAGATC
AACAGCTACTGAGCCAGCTCCGGCTGTGGTTTCACTGTCATACTATTGTTTTATTGTATTTTGAGCCCTAAGATGTTTCTTCTGAAGTAAACAGCTAAAG
AGAGTCCTGTTCAATTTCGTAATAAGTGTTCCAAGCATCTGTCTGTCTATCTATGCCTGTATATATTCAGCACTGCTCAACTTTTATTTGCGCATTTGTT
GGTAGCACTTGGGGAAGAAGATAAGAGTACGat
page-top