Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2184
Contig Information
Length 678 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 37 Clones [Download: CSV  ,  FASTA ]
whfl1o15    rwhfl10c20    whfl15g19    whfl10c20    rwhfl15g19    whfl1i22    rwhfl18m06    rwhfl10c02    rwhfl52l04    rwhfl27a21    rwhfl52m08    whfl36b14    whfl18m05    whfl53m05    rwhfl53m05    whfl18m06    whfl27a21    whfl53b22    rwhfl53b22    whfl50e14    whfl33f03    whfl39f17    whfl52l04    whfl48d10    whfl10c02    rwhfl44m20    rwhfl9m15    whfl9m15    whfl7a19    whfl44m20    whfl52m08    whfl28a21    rwhfl48d10    rwhfl7a19    rwhfl28a21    rwhfl1o15    rwhfl1i22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glycoprotein [Bromus inermis]
Score 592
Evalue 1.57769e-59
Total Hit Count 303
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2184
agTGCGTCTCAGTCATCCGTCTGGAACAGCGATGACTCGAGAACCGTCCTCTTGCCTTTCTGCCCGCCCACCCGTCTCCTCGCCTCGCCGTCTCGCCCCA
CGCCACCGCCGCAGCCGCTGCAAAGATGCCGTTCAAGAGGTTCGTCGAGATCGGGCGGGTGGCCCTGGTGAACTACGGCAAGGACTACGGCCGCCTCGTC
GTCATCGTTGACGTTGTCGACCAGAACCGGGCACT*TGTGGATGCTCCCGATATGGTCAGGTGCCAGATGAACTTCAAGCGTCTTTCGCTGACCGACATC
AAGATTGACATCAAGCGTATCCCTAAGAAGGCCACTTTGATCAAGGCCATGGAGGAAGCTGATGTGAAAACCAAATGGGAGAACAGCTCATGGGGTAAGA
AGCTTGTTGTCCAGAAGAGAAGAGCATCGCTGAATGACTTTGACAGGTTCAA*GGTCATGTTGGCTAAGATTAA*GAGGGGTGGTGCTATCAGGCAAGAG
CTTGCCAAGCTCAAGAAGGAGGTTGCTGCTTAGAATATCTTAGTGGATGACATGTTGAGTTTTTTGTTCCAAGTTGGATCTGCT*CTATGTTCCAGTGTT
CTTGAAGCCAGAATTAGTACAACTGTTTTCAGCGAACTATTTCATATTTTGTC*ATGGTTGTTATTGAATACCCAAgc
page-top