Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2076
Contig Information
Length 777 bp
Tissue Shoot grown under continuous light
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkp5a13    whkp14k09    rwhkp5a13    rwhkp14k09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative fructose 1-,6-biphosphate aldolase [Triticum aestivum]
Score 925
Evalue 5.15561e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2076
TCTGCCAGGAGAATGGGCTGGTGCCCATTGTTGAGCCTGAGATCCTTGTTGATGGACCTCATGACATTGACCGCTGTGCTTACGTGACTGAGATGGTCCT
TGCTGCGTGCTACAAGGCCCTCAACGACCAGCATGTCCTCCTTGAGGGCACCCTCCTGAAGCCCAACATGGTCACCCCTGGATCCGACGCCAAGAAGGTG
GCCCCTGAGGTGATTGCTGAGTACACCGTCCGCACCCTCCAGAGGACTGTCCCTGCTGCCGTCCCAGCCATTGTCTTCCTCTCTGGTGGACAGAGCGAGG
AGGAGGCGACCCTGAACCTGAACGCCATGAACAAGCTCGAGACCAAGAAGCCATGGAACCTGTCCTTCTCCTTCGGGCGTGCCCTCCAGCAGAGCACCCT
CAAGGCCTGGGCTGGCAAGGTGGAGAACGAGGAGAAGGCCAGGAAGGCGTTCCTGGTGAGGTGCAAGGCCAACTCTGAGGCCACCCTCGGCACCTACAAG
GGCGATGCCACCCTCGGCGAGGGGGCCTCTGAGAGCCTCCACGTCAAGGACTACAAGTACTGATCTGCCTTCGGTGCGGTGGCCTGTTTGGGTGTCCTGC
TTACCAGTATTATCGTTTGGTTTTCAGAGTCTTGATATATCCTTCGGATATCGAACCTAGTATGGAACTTGTGCTCTCAAAATAGCTTAGGTAGTTTCGT
TTTTGGAGTCGAATACCCTGTTACTCGGGTGCTGCGTATCGTAAATCGGAGCGGTGGTTTTTGTTCTAAAAAAAAAA
page-top