Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1980
Contig Information
Length 728 bp
Tissue Shoot grown under continuous light
Clones 4 Clones [Download: CSV  ,  FASTA ]
whkp10a17    whkp4k06    rwhkp10a17    rwhkp4k06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cysteine protease [Triticum aestivum]
Score 783
Evalue 1.33387e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1980
GCCTTGAGAGAGAAAAGGATTACCCTTACACCGGGAAGGACGGTACCTGCAAATTTGAGAAGTCCAAGGTTGCTGCTTCAGTTCAAAACTTCAGCGTTGT
CGCTGTTGATGAAGAACAGATTGCTGCTAACCTTGTGAAATACGGACCGCTGGCCATCGGTATCAACGCCGCATACATGCAGACATACATTGGCGGAGTG
TCATGCCCATACATCTGCGGCAGGCACCTCGACCACGGCGTCCTCCTCGTTGGCTACGGGGCGTCCGGGTTCGCACCTTCCCGCTTCAAGGAGAAGCCCT
ACTGGATCATCAAGAACTCATGGGGCGAGAACTGGGGGGACAAGGGTTACTACAAGATCTGCAGGGGCTCCAACGTGCGCAACAAGTGCGGCGTCGACTC
CATGGTCTCCACGGTGTCCGCCATGCACGCCTCGAAGGAGGAGTAGGCTCTGTTCTGGTCTGATCGTCAGCCCTCGTGGAGTCGATCTTGGTTTCGGTGT
ATCGCTAGAAAGAAACTTCAATAGTACCGTAGTAGTCGGCTAGGCTCCATCGTCGTTGTGGTATCAGCAGCGAAGATGCGAAGCCGCAACAGAAAATGCT
TGCTGTATAACTTATGCATTTGCTAAATTTGCTACGCCATGCATGTCTGCCACACGCTATTTGGATGTGGCTAAAGAACTCCTGAATAATTCTGTACATA
ATATGTATTGTTTCCATCAAAAAAAAAA
page-top