Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2169
Contig Information
Length 955 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 35 Clones [Download: CSV  ,  FASTA ]
rwhfl51d07    rwhfl46j15    rwhfl2b19    rwhfl37c13    rwhfl54a22    rwhfl24o15    rwhfl6p05    rwhfl38c20    rwhfl14d13    rwhfl12a23    rwhfl13f22    rwhfl55h21    rwhfl15c14    rwhfl10g20    rwhfl10d24    rwhfl24p04    rwhfl38c13    rwhfl24p03    whfl6p05    whfl12a23    whfl55h21    whfl38c20    whfl46j15    whfl10d24    whfl3b19    whfl51d07    whfl10g20    whfl37c13    whfl2b19    whfl38c13    whfl12a24    whfl15c14    whfl14d13    whfl24p04    whfl24p03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192774 [Zea mays] >gi|195617050|gb|ACG30355.1| 40S ribosomal protein S9 [Zea mays]
Score 889
Evalue 1.09708e-93
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2169
aggcttgtcaaatcgataaacaagatacgtttggttcacaaaaaacgaagcagCCTCAAGAGTTCACTTCTGCTCGGTGGTCACTAACCAAGCAAAACCG
ACACACATAAGTTTAATTTTAGAACCGACAGCCAAAAGATTCTGAACCAACGAAAGCTCTACACCACTAAGTTTCTAAGAAGGAAAGTTTGAATCATTTC
CGAGTTCCACAAGGCAATCTCAACATTTCTGCAACGAAAGTTATGCGGGTGAGGCTGGGCGCTTAGTCTTCCTCCTCCTCGCCGTCATCACCACCACCAC
CTGAGGCCTTCTTCTGGTTCTTCCGCTTCACTCTTCCAGGTTGGCCACCACCCAGTGGGCTGGTGAGAGAGAAGTCGACGTGCTTCTCAGTGTCCACCCT
CACCATGAAAGAAGGAATGTTGACAAGCTGCTTTCCAACCCTGATGTGGCGCTGTCTGATAAGGACACGAGCATGATGGATTGACTTGGCCAT*GCCATT
CTTGAAGACGATGGTCTGGAGACGGCGCTGGAGGAAGTTGTCAACAGTGAGGGCAAGCACATAATCAAGCTTGTTCTGTTCCTCAGTGAGAAGACCGTAG
CGGTTCATGCGGCGGAGGAGCGCTGCACCCTCAAAGATACGGCGGGGGTTCTTCTCATCCAGGGTGAGCAGCTCCCTGGCAGCATTTCGGATGCGGCTGA
GGGCGTACTGCACACGGTAGAGCTCACGCTTGGCCCGCAGA*CCGTACTCCCCAACCAGCTTCAGCTCAGCGTCAAGACGCTCCTTCTCATACGGACGCC
TTGG*CTTCTTGAAGGTCTTCCCATAGTTGCGGTAGAAGTTGACGTGCACCATGGCTGCCGCCTCCTCAGGATCGCTCGGGTCGTCGagctgtgcgccgc
cggtgctggggtgaggggatcggtggagagtcatcgctgttccagacagcgatga
page-top