Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2157
Contig Information
Length 620 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 32 Clones [Download: CSV  ,  FASTA ]
whfl10j24    whfl14k23    whfl8h04    whfl20g20    whfl18k11    whfl42l07    whfl19o19    whfl44d11    whfl10d18    whfl39c07    whfl48m02    whfl28p21    whfl29l08    whfl36a14    whfl54k14    whfl11n20    whfl39a10    whfl45j18    whfl8i23    whfl17l24    whfl30l08    whfl51o19    whfl14h15    whfl35k11    whfl15k22    whfl32d12    whfl36e16    whfl50o05    whfl27n16    whfl36o04    whfl11h03    whfl2e23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14101 [Oryza sativa Indica Group]
Score 808
Evalue 1.17875e-84
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2157
tcATCGCTGTCTGGAACAGGCTCTCCCGAGTCCGCAGCAGCCGCCGCCAGCAGCTGCGCAAAGGCTCGACAAACCCTAACCCTAGTCCATAGCTAGCTTA
GCTTCCTTCCTCTCGATCTAGCTAGAGCCATGGCGCCGACCAAGGGCGAGGGGCCGGCCATCGGCATCGACCTCGGCACCACCTACTCGTGCGTCGGCGT
GTGGCAGCACGACCGCGTCGAGATCATCGCCAACGACCAGGGCAACCGCACCACGCCCTCGTACGTCGCCTTCACCGACTCGGAGCGCCTCATCGGCGAT
GCCGCCAAGAACCAGGTCGCCATGAACCCCATCAACACCGTCTTCGATGCGAAGCGTCTTATTGGCA*GAAGGTTTGCTGATGCCCCTGTCCAGAGTGAT
ATTAAGATGTGGCCGTACAAGGTTATTCCTGGCCCCGCAGACAAGCCTATGATTGTAGTGCAGTACAAGGGTGAGGACAAGCAGTTCTCAGCTGAAGAAA
TTTCTTCCATGGTCCTCATCAAGATGCGTGAGATCGCTGAGGCTTACCTAGGAGTAACTATTAAGAATGCTGTTGTCACCGTGCCTGCTTACTTCAATGA
TTCCCAGAGGCAGGCAacca
page-top