Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1714
Contig Information
Length 836 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10a22    whkp20o05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit beta tubulin 5 [Hordeum vulgare subsp. vulgare]
Score 944
Evalue 7.03032e-127
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1714
CCCCCTCCCCCGCAACCACCACCACCGGACCACCGTCACCGGCGGCGAAGGCACGATGAGGGAGATCCTGCACATACAGGGCGGGCAGTGCGGGAACCAG
ATCGGGGCCAAGTTCTGGGAGGTGATCTGCGACGAGCACGGGATCGACGGGACGGGGCGCTACGCGGGGGACTCGGACCTGCAGCTGGAGCGGATCAACG
CTCTACTACAACGAGGCCAGCGGGGGCCGGTTCGTGCCCCGCGCCGTGCTCATGGACCTCGAGCCCGGCACCATGGACTCGGTGCGCTCCGGCCCCTTCG
GCCAGATCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGCGCCGGCAACAACTGGGCCAAGGGACACTACACCGAGGGCGCCGAGCTCATCGATTC
CGTCCTCGACGTCGTCCGCAAGGAGGCCGAGAACTGCGACTGCCTCCAGGGATTCCAAGTTTGCCATTCCTTGGGAGGAGGCACTGGATCTGGGATGGGC
ACCCTTCTTATTTCTAAGATTAGGGAGGAGTACCCTGACCGAATGATGCTGACATTCTCTGTCTTCCCATCACCAAAGGTCTCCGACACCGTTGTTGAGC
CATACAATGCTACACTTTCTGTTCACCAACTTGTTGAGAACGCTGATGAGTGTATGGTGCTTGACAATGAAGCTCTATACGACATATGCTTCCGCACACT
AAAGCTTGCCACCCCTTCCTTTGGTGACCTGAACCATCTTATCTCTGCTACCATGANCGGTGTCACATGCTGCCTGANGTTCCCTGGNACAACTCAACTC
CNATCTTCNCAAGCTTGCTGTGAATCTCATCCCATT
page-top