Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1713
Contig Information
Length 1079 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10a21    rwhkp10a21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Mitochondrial outer membrane porin; AltName: Full=Voltage-dependent anion-selective channel protein; Short=VDAC >gi|456672|emb|CAA54788.1| voltage dependent anion channel (VDAC) [Triticum aestivum]
Score 1347
Evalue 1.04293e-146
Total Hit Count 428
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1713
AACCCACGCAGCTCCAGCGGCGCAGGCGCATCCCAGCTCACCGGCGGAGATGGGCGGCCCAGGCCTCTACTCCGGGATCGGCAAGAAGGCCAAGGATCTG
CTGTACAGGGACTACCAGACCGACCACAAATTCACCCTTACCACCTACACCGCCAATGGCGCCGCAATTACTGCTACCAGTACAAAGAAGGCTGATCTTA
TACTCGGTGAGATCCAATCACAGATCAAGAACAAAAACATCACTGTAGATGTGAAGGCCAACTCAGCATCGAATGTCATTACTACAATTACTGCTGACGA
TCTTGCAGCACCAGGGCTGAAGACCATCTTGAGCTTTGCTGTTCCTGATCAGAAATCTGGAAAGGTTGAGCTCCAGTACTTGCATGATTATGCTGGTATT
AATGCAAGCATTGGCTTGACTGCCAATCCTGTAGTCAACCTCTCCGGCGCGTTCGGAACTAGTGCTCTAGCTGTTGGTGCTGACGTGTCGCTTGATACAG
CCACCAAGAATTTCACCAAATACAATGCTGCACTTAGCTACACTAACCAGGATCTTATTGCATCCCTGAACCTGAACAACAAGGGAGACAGCCTGACCGC
ATCCTATTACCACATTGTGGAGAAATCCGGCACAGCTGTCGGGGCAGAGCTGACCCACAGCTTCTCGAGCAACGAGAACAGCCTCACCTTCGGCACCCAG
CATACCCTGGACCCGCTCACCCTTGTGAAGGCCCGCATCAACAACTCTGGCAAGGCCAGCGCGCTGATCCAGCACGAGTTCAGGCCAAAGTCGCTGTGCA
CCATCTCGGCGGAGGTGGACACCAAGGCCATCGAGAAGAGCTCGAAGGTCGGAATCGCGATTGCTCTCAAGCCTTAATGGCGAAGTCAAGCCCCTCTTCT
CTAAGCTCTCAGGGGTGTTCCTCGGTTTCGGATGAAATCGGGGCGGGTTGACAATACTTCACACGCCTTGGGCGCGTTGTTGCAGTCTGTTAGATTTGAA
GAACTGCCGTGTTTCATTCCTGAGGAATTTTGTCTTTGCTGCGGTGTAGTGCCTGTCCGTTGAGCCACACTTCTCAGTA
page-top