Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2146
Contig Information
Length 786 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 31 Clones [Download: CSV  ,  FASTA ]
rwhfl14i08    rwhfl10e06    rwhfl14i19    rwhfl36h01    rwhfl37h01    rwhfl8k10    rwhfl17p04    rwhfl17p03    rwhfl23d11    rwhfl44p05    rwhfl10p14    rwhfl38b02    rwhfl15o20    rwhfl55c09    rwhfl17p15    rwhfl22p10    rwhfl37b13    whfl55c09    whfl8k10    whfl10p14    whfl44p05    whfl37b02    whfl10e06    whfl38b02    whfl36h01    whfl17p03    whfl15o20    whfl14i19    whfl14i08    whfl17p04    whfl37h01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0418000 [Oryza sativa (japonica cultivar-group)] >gi|75303612|sp|Q8S857|H2AV2_ORYSJ RecName: Full=Probable histone H2A variant 2 >gi|20042981|gb|AAM08789.1|AC016780_19 Putative histone H2A [Oryza sativa] >gi|31432099|gb|AAP53784.1| Histone H2A variant, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639220|dbj|BAF26525.1| Os10g0418000 [Oryza sativa (japonica cultivar-group)] >gi|125531934|gb|EAY78499.1| hypothetical protein OsI_33592 [Oryza sativa Indica Group] >gi|125574806|gb|EAZ16090.1| hypothetical protein OsJ_030299 [Oryza sativa (japonica cultivar-group)] >gi|215768300|dbj|BAH00529.1| unnamed protein product [Oryza sativa Japonica Group]
Score 517
Evalue 1.0701e-50
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2146
taacctGGATATCCATgAA*GACGAATAGTAAGGATTGTCTGGTCTTCAGGAAACCAAATATAAGTGGTTCCATATCACGATTACATTTGCCAAGTCTTT
CCCTAATAACAAGTTACCGAAAGCTAGCCCCATCACAAATTCAGACAACCTATTCAGGTTGTGATAATAGCAACACATCACAGATAGCACAACATAACAA
GGGATCACGAAGATACAAAGCACAACTACCCGTTATTGCGTTTCATTCACTCCTTGGAGGTCTTGTTGATGAGGGAC*TTGTGGATGTGAGGGATGACAC
CACCACCA*GCGATGGTGCCCTTGATGAGGGTGTCCAGCTCCTCGTCTCCACGGATCGCGAGCTGCAGGTGGCGAGGGGTGATACGCTTCACCTTGAGAT
CCTTGCTGGCGTTGCCGGCCAGCTCAAGGACCTCGGCAGTGAGGTACTCAAGGATTGCTGCAGAGTACACAGCGGCAGTGGCACCCACACGGCCATTAGC
CGAGACCCTCTGCTTGAGCTGCCTGTGTATACGGCCCACCGGGAACTGAATCCCGGCACGGGACGAGCGGGACACAGGCGCCTTCTTCTTGTCCTTGTCC
*TTGTCGGCGGCGCCCTTGGGCCGCCGTCGTCTTCGCCGCAAGCAGCCCCTTGCCTCCCTTCCCGGCCATCTCCCTTCGCAGCAGAGCCCCCTGGCTTCC
TCTCGCCTCTCTCGGTCTTAGAACTGACTGGGGGCTTGGGTGCTTCTCTCCTCTTCcggttctcgagtcatcgctgtctggaacag
page-top