Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1700
Contig Information
Length 1041 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10a23    rwhkp10a23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit aldehyde dehydrogenase, putative [Oryza sativa (japonica cultivar-group)] >gi|125576462|gb|EAZ17684.1| hypothetical protein OsJ_031893 [Oryza sativa (japonica cultivar-group)]
Score 963
Evalue 1.0477e-134
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1700
AATGGTAATGTAGCCCGCGTAGTGTTGGCAGCAGCTGCGAAGCATCTAACCCCTGTTGCTCTGGAGCTCGGTGGAAAATGCCCTGTTATTGTTGACTCTA
ACGTCGATCTGCATGTTGCTGCTAAGAGGATTGCTGTTGGTAAATGGGGCTGTAACAATGGCCAGGCATGCATTGCTCCCGATTACATCATAACGACAAA
AAGCTTTCGTTACAGAACTGGTCGACTCTTTGAAAAGAGTCTTGGAAAGGTTCTATGGGGAGGATCCGTTGCAATCGGCGGACCTGTCTCGTATTGTGAG
TATTAGCCATTTCGAACGATTAGCGAAGTTGATAGAGGACAAGGAAGTTGCCACCAAGATTCAGCTCGGTGGTCAGACAGATCAGGAGCAACTAAAAATA
GCTCCTACGGTGTTGGTAGATGTTCCTCTTGATACAGAACTTATGACAGGGGAAATATTTGGCCCCATGCTTCCAATTATAACGGTCGACAAGATTGAAG
AAAGCATCACACACATCAACGCCGGGGCGAAGCCACTGGCGGCCTACCTCTTCACCAAGGACAAGAAACTGCAACAAGATTTCGTCTCAAACGTCTCGGC
AGGAGGCATGCTCGTCAACGACGTCGCCCTACACCTGACGAACCCACATTTGCCGTTCGGTGGCGTGGGCGACAGCGGCACGGGGTCGTACCATGGCAAG
TTCAGCTTCGACTGCTTCACCCACAGAAAGGCAGTGCTGATCCGCGGGTTCGGTGGCGAGGCGAACGCAAGGTACCCACCCTACACGGCAGAGAAACAGA
GGATCTTGAGGGGCCTCATCAAGGGCAGCTTCTTTGCGCTGATCCTTGCGCTCCTGGGGTTCCCAAGGGAGAAGCGTTAGCTGAGTTGAGTTCCCTCCCT
TCTCCAGTACAGCATAGCAGGATTGTTCATGTTCATGAGGGTGATGTGCAGGACTGGTGATGTGGTGCACTTCTGCACTGTGAAGCGCCAGTGCGCGAGT
GTGTTCAACAGGTGTAAAATATGGGACTATCATCGGATTTC
page-top