Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1686
Contig Information
Length 563 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10a04    rwhkp10a04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Defender against cell death 2; Short=DAD-2 >gi|5918185|emb|CAB56224.1| defender against death (dad) 2 [Hordeum vulgare]
Score 559
Evalue 6.92306e-56
Total Hit Count 172
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1686
CTCACCTCTGCATCTTCGCGTCGTCGTCTTCACAGCACAGCTCGAAGCTCGCGGGGAAGCAAGGATGCCGAAGCCCGCGGGGGACGCCAAGCTCCTGATC
CAGTCCCTGAACAAGGCCTACGCCGCCACGCCCACGAATCTCAAGATCATTGACCTGTACGTGGTTTTCGCCGTCGCAACTGCCCTGGTTCAGGTCGTTT
ACATGGGAATAGTTGGGTCATTCCCCTTCAACTCTTTCCTGTCTGGTGTCCTGTCATGCATTGGAACTGCAGTGCTTGGTGTTTGCCTCCGTATCCAAGT
CAACAAGGACAACAAGGAATTCAAGGATCTTCCCCCGGAAAGAGCCTTTGCTGATTTCGTCCTGTGCAATCTGGTGCTCCACCTGGTGATCATGAACTTC
CTCGGATGAGCAACTGTCATACAAGCTGTCGAGACTTTGTAGCGTCCTAATGTCTAAGACTGTCAGCATGTTAGATATTCATGTGGCATCATACACAGCT
ATGTAATCCGAGAGTTTCTCTATGAACTATAAGAATTCAGTGGATTTAGCGTTAAAAAAAAAA
page-top