Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1682
Contig Information
Length 1490 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10d13    rwhkp10d13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0306800 [Oryza sativa (japonica cultivar-group)] >gi|52075712|dbj|BAD44932.1| endoribonuclease E-like protein [Oryza sativa Japonica Group] >gi|52077520|dbj|BAD45322.1| endoribonuclease E-like protein [Oryza sativa Japonica Group] >gi|113532377|dbj|BAF04760.1| Os01g0306800 [Oryza sativa (japonica cultivar-group)]
Score 1565
Evalue 8.66506e-172
Total Hit Count 34
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1682
GCTCACCCGAGACAACCGGGAGTAGAGAGCTTCGGACGAGGAGATGGCCTGCTGGTTGGGGGCAGCCTGCAGAGTGGCGGCAGCGGGGGTCTTGCGGTCT
GAGCGGCAACGACTCAGCCTTCCTCTAGCACTGACGGCGGCAAAGAGGGCCAGCGTCTTGGAGCAGCAACGAGAGGAAGCAGCCGGCAGCGCTCGCGCTG
TCCAAGGGTGTGTGGCGAGCCCAACTACTACTAAGGTGACAGATAACCAAATGGAGAGTGAAGTCGCAATGGGCTACACGATGACCCAAATCTGTGATAG
GTTTATTGAGTTCTTCATGCATGAGAAGCCAGAAACAAAGGACTGGAGAAAAGTATTGGTTTTCAGAGAGGAGTGGCAAAGATACAGACCACACTTCTAC
AAGCACTGCCAAGTGTGTATAGATGTGGAAACTGATACTTCTGTGAAGCAAAAGTTGATTGTACTCGCTAGAAAAGTAAAGAAGATCGATGATGAAATAG
AGACGCACATGGAACTCTTCACAGAGCTCAGAGAGAATCCCACTGATATCAACGCTATTGTTGCGAGACGACGAAAGGATTTCACTGGGGACTTCTTCCG
CAATCTTAATTTTCTTGTAAATGCTTACAATGGCCTTGATGAGCGAGATGCAATTGCCAGGCTTGGGGCCAAGTGTCTATCTGCAATTCATGCATATGAT
TGCACACTGCAGCAGTTGGACATTGATTCTGCTCAATCAAAATTTGATGATATATTGAATTCTTCTTCACTAGATGATGCCTGTGACAAGATAAAAGGAT
TAGCTAAGGCTAAAGAACTTGACTCATCTTTAGTTCTTCTGATTAATAGAGCCTGGGCTGCTGCAAAAGACTCTAAAACTATGAAGAACAAGGTCAAGGA
TATAATGTATCATATTTATACAACTGCAAAGGAAAGCCTCAAAATCATCTCACCTCCAGAGATGAAACTTCTGAAGTACCTACTGAATATTGAAGATCCC
GAAGAGAGATTTGCTGCTCTCGCGTCTGCTTTCTCGCCAGGAGATGAGCACGAAGTCAAGGATGAAGATGCTCTTTACACAACTCCCAACGAACTGCACA
AGTGGATTAAAATGGTGCTCGATTCGTACCATCTCAACAAGGAGGAGACGGATTTCATGGATGCCAGAAGGATGAGCGACCCGGTTATCATCCAGCGATT
AATTCTTCTCAAAGAGACGGTCGAGGAAGAATACATGAAGCAATACATAAACCCTGAGGACCAAGAATCAGAAGACAGGGAAGAACCAGAATTTTGAGCC
TGCAACACCCATGAATCGGTGATGTTTGTAGTAAGATAAGATGTTTTGTAGGTTGCTAGGGCTAGTATTGGTCTTATGAAGTTACAGCCTTACAGAGAGA
TAGTTAGGTTGGTACCATGTAGCAAGTTAAGGTTTAGCTAGAACTTATGTTTTTTCATTACACTGATTACATGTTCGTATGCGATACAAG
page-top