Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1677
Contig Information
Length 873 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10e09    rwhkp10e09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit meiosis 5 [Zea mays]
Score 540
Evalue 2.78114e-53
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1677
AGTTGCTTATTCTGTCCTGTCTGCACACACTGAGAGCAATATGGGTGGCAAGGTTCTTCTGATGAGTGCCGTCTTGGTGGGGCTTGTTTCACTGAGCTCG
TGCAGGAGCCTGGGAGAGTTGCATGAGCAGAAGACCCACTATGGGGGCTCATCAACTCCCACGCATGGGTCAGGAGGAGGCTACAACCCGACACTGACAC
CGACACCAACTTACGGCACTACACCGACGCCATCTTACGGCACTACACCGACACCAACTTACGGCATTACACCGACGCCAACTTACGGCACTACACCGAC
GCCATCTTACGGCACTACACCGACGCCATCTTATGGCACTACACCGAGCACCCCAAGTGCACCTTCCCATGATGTCCCTGCAAGTCCAAAGAAGCATGGG
TTCATTGGATCCTGCGACTACTGGAAGAATCACCCAGATGCTATAGTTGCAGCTATTGGGTCCCTCGGCAACATCGGCAAGACATTTGGTGCTGCATGCA
GTATGATAGGTGGCAAGAAGCTAGGAAATATGCATGATGCACTCTCAAACACTAGAACTGATGGTATTGGCGCCCTGATACGTGAGGGGGCAGCTGCATA
CCTCAACTCCATTGTGAACAAGAAGTTCCCATTTACCACCCAGCAGGTGAAGGACTGTATCGTCGTGGCCGTGACCTCTGATGGTGCTGCTTCTGCCCAA
GCTGGGGTTTTCAAGAAGGCAAATGAATTCCACTACTAGTTTCAGTCATCGGTGTTTCTTGGCTAAATTTCTTCCTCCCGCGCATTTTTCTTGATTGATG
CTATCTTGTGGCTTGATATATTTCTTTTATTTTTGTTGTTTTATCATGTAATATCACTATCTATGGCATTTGA
page-top